Mutagenetix > Incidental Mutation

Incidental Mutation 'R2568:Nek10'

254654

Institutional Source

Beutler Lab

Gene Symbol

Nek10

Ensembl Gene

ENSMUSG00000042567

Gene Name

NIMA (never in mitosis gene a)- related kinase 10

Synonyms

LOC238944

MMRRC Submission

040427-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14803415-15012059 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14999112 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1037 (E1037G)

Ref Sequence

ENSEMBL: ENSMUSP00000153142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]

AlphaFold

Q3UGM2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112630
AA Change: E1037G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: E1037G

Domain	Start	End	E-Value	Type
ARM	197	238	8.23e1	SMART
ARM	278	320	5.18e0	SMART
low complexity region	387	400	N/A	INTRINSIC
ARM	401	448	7.09e1	SMART
S_TKc	519	791	2.36e-75	SMART
low complexity region	799	811	N/A	INTRINSIC
low complexity region	839	863	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112631
AA Change: E1048G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: E1048G

Domain	Start	End	E-Value	Type
ARM	197	238	8.23e1	SMART
ARM	278	320	5.18e0	SMART
low complexity region	387	400	N/A	INTRINSIC
ARM	401	448	7.09e1	SMART
S_TKc	519	791	2.36e-75	SMART
low complexity region	799	811	N/A	INTRINSIC
low complexity region	839	863	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136826

SMART Domains

Protein: ENSMUSP00000123151
Gene: ENSMUSG00000042567

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	87	5.1e-13	PFAM
Pfam:Pkinase_Tyr	1	87	4.2e-8	PFAM
low complexity region	103	115	N/A	INTRINSIC
low complexity region	143	167	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	257	268	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224491
AA Change: E1037G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,201,269	V1010A	possibly damaging	Het
4930563D23Rik	A	G	16: 92,321,319	L27P	probably damaging	Het
A730071L15Rik	A	T	11: 6,200,161		probably benign	Het
Abca13	A	T	11: 9,333,310	N3244I	probably benign	Het
Adgrf5	A	G	17: 43,437,671	T219A	probably damaging	Het
Adgrg5	A	T	8: 94,934,021	N92I	probably damaging	Het
Agt	A	C	8: 124,556,955	V475G	probably damaging	Het
Akap6	A	G	12: 52,887,278	K518E	possibly damaging	Het
Apoh	T	G	11: 108,404,871	D133E	probably benign	Het
Axdnd1	T	A	1: 156,392,749	M234L	possibly damaging	Het
Cacna1d	A	G	14: 30,082,511	I1335T	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cfap206	T	A	4: 34,711,566	K444*	probably null	Het
Clasp2	A	G	9: 113,878,764	I614M	probably benign	Het
Col6a4	A	T	9: 106,063,076	D1218E	possibly damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
D130043K22Rik	C	T	13: 24,883,891	T870M	probably damaging	Het
Dagla	C	A	19: 10,248,152	A883S	probably benign	Het
Dhx30	A	G	9: 110,097,195	V87A	probably damaging	Het
Dtx1	C	A	5: 120,710,184	V44L	possibly damaging	Het
Ecm2	T	A	13: 49,530,129	S528T	possibly damaging	Het
Egfem1	A	T	3: 29,582,931	N172I	probably damaging	Het
Fam102b	T	A	3: 108,978,848	N356I	probably benign	Het
Fam13a	T	G	6: 58,935,609	R686S	probably damaging	Het
Fmo1	T	A	1: 162,836,259	I234L	probably benign	Het
Foxj2	C	T	6: 122,828,372	R68W	probably damaging	Het
Foxo6	A	T	4: 120,268,764	M278K	probably benign	Het
Fsip2	A	G	2: 82,990,431	S5503G	probably benign	Het
Gdf5	C	G	2: 155,942,090	R100G	probably benign	Het
Il1b	A	T	2: 129,367,322	D129E	probably damaging	Het
Klhl29	A	G	12: 5,091,350	S545P	probably damaging	Het
Krt83	G	T	15: 101,487,827	R296S	possibly damaging	Het
Llgl1	T	G	11: 60,708,812	S509R	probably damaging	Het
Lmod1	A	T	1: 135,363,964	K186*	probably null	Het
Lrpprc	C	T	17: 84,726,649	A973T	probably damaging	Het
Marco	T	C	1: 120,494,785	H49R	possibly damaging	Het
Mylk4	T	C	13: 32,722,018	N394S	probably null	Het
Myo5a	A	G	9: 75,123,040	Y147C	probably damaging	Het
Myo5a	T	C	9: 75,151,897	V469A	probably damaging	Het
Myot	A	G	18: 44,337,216	T87A	probably benign	Het
Nav2	A	G	7: 49,597,564	H2154R	probably damaging	Het
Olfr181	A	G	16: 58,925,923	V216A	probably benign	Het
Olfr341	T	C	2: 36,479,974	D52G	probably damaging	Het
Olfr677	A	G	7: 105,056,671	T142A	probably benign	Het
Pitrm1	G	T	13: 6,575,092	V869F	probably benign	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Prdx1	T	G	4: 116,693,800	I156S	probably benign	Het
Rbks	T	A	5: 31,665,752	T107S	probably damaging	Het
Ryr3	G	A	2: 112,675,874	R3468W	probably damaging	Het
Scn1a	C	T	2: 66,273,469	D1805N	probably damaging	Het
Sirpa	T	C	2: 129,615,648	V214A	probably benign	Het
Slc35c1	T	C	2: 92,458,880	N94D	probably benign	Het
Sorbs2	A	T	8: 45,795,370	K553*	probably null	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Thg1l	A	G	11: 45,951,565	V142A	probably benign	Het
Tiparp	T	A	3: 65,553,130	Y513*	probably null	Het
Tmc6	A	G	11: 117,772,820	V522A	probably benign	Het
Trim39	T	A	17: 36,269,164		probably benign	Het
Trrap	G	A	5: 144,843,369		probably null	Het
Tulp3	C	T	6: 128,327,638	V218I	probably benign	Het
Vmn1r38	T	A	6: 66,776,971	I54F	probably benign	Het
Vmn2r23	T	A	6: 123,742,188	Y833*	probably null	Het
Zfp810	A	T	9: 22,279,238	S125T	probably benign	Het

Other mutations in Nek10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Nek10	APN	14	14850957	missense	probably damaging	0.99
IGL02067:Nek10	APN	14	14861639	missense	probably benign	0.12
IGL02361:Nek10	APN	14	14843856	missense	probably damaging	1.00
IGL02687:Nek10	APN	14	14840570	missense	probably damaging	1.00
IGL02929:Nek10	APN	14	14821119	missense	possibly damaging	0.82
IGL03229:Nek10	APN	14	14986686	missense	probably benign	0.10
P0041:Nek10	UTSW	14	14861603	missense	probably benign	0.01
R0007:Nek10	UTSW	14	14840574	missense	probably benign	0.10
R0007:Nek10	UTSW	14	14840574	missense	probably benign	0.10
R0142:Nek10	UTSW	14	14861560	missense	possibly damaging	0.96
R0433:Nek10	UTSW	14	14860927	missense	probably benign	0.32
R0633:Nek10	UTSW	14	14857782	critical splice acceptor site	probably null
R1087:Nek10	UTSW	14	14827059	missense	possibly damaging	0.59
R1184:Nek10	UTSW	14	14931325	splice site	probably benign
R1250:Nek10	UTSW	14	14853887	missense	probably damaging	1.00
R1371:Nek10	UTSW	14	14850983	missense	probably damaging	0.98
R1506:Nek10	UTSW	14	14999078	splice site	probably benign
R1829:Nek10	UTSW	14	14863454	critical splice acceptor site	probably null
R1831:Nek10	UTSW	14	14842789	missense	probably benign
R1833:Nek10	UTSW	14	14842789	missense	probably benign
R1990:Nek10	UTSW	14	14860764	missense	probably benign
R1997:Nek10	UTSW	14	14827003	missense	probably benign	0.09
R2011:Nek10	UTSW	14	14885122	missense	probably damaging	1.00
R2158:Nek10	UTSW	14	14885047	splice site	probably null
R2288:Nek10	UTSW	14	14853956	nonsense	probably null
R2907:Nek10	UTSW	14	14980613	missense	possibly damaging	0.81
R2965:Nek10	UTSW	14	14836202	missense	probably damaging	1.00
R3922:Nek10	UTSW	14	14861585	missense	possibly damaging	0.88
R4032:Nek10	UTSW	14	14853877	splice site	probably null
R4700:Nek10	UTSW	14	14842841	missense	possibly damaging	0.69
R4742:Nek10	UTSW	14	14861624	missense	probably null	0.03
R4785:Nek10	UTSW	14	14855714	missense	probably benign
R4890:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4891:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4920:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4924:Nek10	UTSW	14	14846594	splice site	probably null
R4928:Nek10	UTSW	14	14930577	missense	probably damaging	1.00
R4948:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4952:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R4953:Nek10	UTSW	14	14860986	missense	possibly damaging	0.47
R5092:Nek10	UTSW	14	14820851	missense	possibly damaging	0.81
R5097:Nek10	UTSW	14	14857851	missense	probably benign	0.00
R5593:Nek10	UTSW	14	14980544	nonsense	probably null
R5696:Nek10	UTSW	14	14860736	splice site	probably null
R5813:Nek10	UTSW	14	14986704	missense	probably benign	0.01
R5829:Nek10	UTSW	14	14865404	missense	probably damaging	1.00
R5872:Nek10	UTSW	14	14850896	missense	probably benign	0.06
R5939:Nek10	UTSW	14	14931290	missense	possibly damaging	0.58
R6025:Nek10	UTSW	14	14865633	missense	probably benign	0.41
R6235:Nek10	UTSW	14	14821113	nonsense	probably null
R6539:Nek10	UTSW	14	14860789	missense	possibly damaging	0.94
R6542:Nek10	UTSW	14	14999108	missense	probably benign	0.44
R6561:Nek10	UTSW	14	14828448	missense	possibly damaging	0.48
R6659:Nek10	UTSW	14	14861684	missense	probably benign	0.29
R7039:Nek10	UTSW	14	14826946	missense	possibly damaging	0.63
R7039:Nek10	UTSW	14	14986700	missense	probably damaging	0.99
R7102:Nek10	UTSW	14	14828517	missense	probably damaging	1.00
R7185:Nek10	UTSW	14	14846621	missense	probably benign	0.03
R7198:Nek10	UTSW	14	14850947	missense	probably damaging	0.99
R7202:Nek10	UTSW	14	14836171	missense	probably benign	0.01
R7251:Nek10	UTSW	14	14853965	missense	probably benign
R7345:Nek10	UTSW	14	14955503	missense	probably benign
R7590:Nek10	UTSW	14	15006693	makesense	probably null
R7593:Nek10	UTSW	14	14826955	missense	probably benign	0.04
R7616:Nek10	UTSW	14	14937759	missense	probably benign	0.27
R7635:Nek10	UTSW	14	14850932	missense	probably benign	0.01
R7817:Nek10	UTSW	14	15001017	missense	probably benign	0.00
R7826:Nek10	UTSW	14	14860846	splice site	probably null
R7986:Nek10	UTSW	14	15001020	missense	probably benign	0.17
R8765:Nek10	UTSW	14	14999104	missense	probably damaging	0.97
R8856:Nek10	UTSW	14	14937610	missense	probably damaging	0.96
R8973:Nek10	UTSW	14	14931321	critical splice donor site	probably null
R9002:Nek10	UTSW	14	14980590	missense	probably damaging	1.00
R9088:Nek10	UTSW	14	14931314	missense	probably damaging	1.00
R9195:Nek10	UTSW	14	14821139	missense	probably benign	0.03
R9464:Nek10	UTSW	14	14937766	missense	probably benign
R9511:Nek10	UTSW	14	14828511	missense	probably benign	0.05
R9529:Nek10	UTSW	14	14850833	missense	probably benign
R9590:Nek10	UTSW	14	14853888	missense	probably damaging	1.00
Z1177:Nek10	UTSW	14	14853948	missense	probably benign	0.00
Z1177:Nek10	UTSW	14	15001157	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCTGTTTACTAGGATCCACGG -3'
(R):5'- ACTCAGTGTATCTCCAACTGCTG -3'

Sequencing Primer
(F):5'- TGTTTACTAGGATCCACGGAACCC -3'
(R):5'- TGCTGCCTCAGTGAACAAG -3'

Posted On

2014-12-04