Incidental Mutation 'R2568:Nek10'
ID254654
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene NameNIMA (never in mitosis gene a)- related kinase 10
SynonymsLOC238944
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location14803415-15012059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14999112 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1037 (E1037G)
Ref Sequence ENSEMBL: ENSMUSP00000153142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112630
AA Change: E1037G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: E1037G

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112631
AA Change: E1048G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: E1048G

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136826
SMART Domains Protein: ENSMUSP00000123151
Gene: ENSMUSG00000042567

DomainStartEndE-ValueType
Pfam:Pkinase 1 87 5.1e-13 PFAM
Pfam:Pkinase_Tyr 1 87 4.2e-8 PFAM
low complexity region 103 115 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224491
AA Change: E1037G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14850957 missense probably damaging 0.99
IGL02067:Nek10 APN 14 14861639 missense probably benign 0.12
IGL02361:Nek10 APN 14 14843856 missense probably damaging 1.00
IGL02687:Nek10 APN 14 14840570 missense probably damaging 1.00
IGL02929:Nek10 APN 14 14821119 missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14986686 missense probably benign 0.10
P0041:Nek10 UTSW 14 14861603 missense probably benign 0.01
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0142:Nek10 UTSW 14 14861560 missense possibly damaging 0.96
R0433:Nek10 UTSW 14 14860927 missense probably benign 0.32
R0633:Nek10 UTSW 14 14857782 critical splice acceptor site probably null
R1087:Nek10 UTSW 14 14827059 missense possibly damaging 0.59
R1184:Nek10 UTSW 14 14931325 splice site probably benign
R1250:Nek10 UTSW 14 14853887 missense probably damaging 1.00
R1371:Nek10 UTSW 14 14850983 missense probably damaging 0.98
R1506:Nek10 UTSW 14 14999078 splice site probably benign
R1829:Nek10 UTSW 14 14863454 critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14842789 missense probably benign
R1833:Nek10 UTSW 14 14842789 missense probably benign
R1990:Nek10 UTSW 14 14860764 missense probably benign
R1997:Nek10 UTSW 14 14827003 missense probably benign 0.09
R2011:Nek10 UTSW 14 14885122 missense probably damaging 1.00
R2158:Nek10 UTSW 14 14885047 splice site probably null
R2288:Nek10 UTSW 14 14853956 nonsense probably null
R2907:Nek10 UTSW 14 14980613 missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14836202 missense probably damaging 1.00
R3922:Nek10 UTSW 14 14861585 missense possibly damaging 0.88
R4032:Nek10 UTSW 14 14853877 synonymous probably null
R4700:Nek10 UTSW 14 14842841 missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14861624 missense probably null 0.03
R4785:Nek10 UTSW 14 14855714 missense probably benign
R4890:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14846594 splice site probably null
R4928:Nek10 UTSW 14 14930577 missense probably damaging 1.00
R4948:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14820851 missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14857851 missense probably benign 0.00
R5593:Nek10 UTSW 14 14980544 nonsense probably null
R5696:Nek10 UTSW 14 14860736 splice site probably null
R5813:Nek10 UTSW 14 14986704 missense probably benign 0.01
R5829:Nek10 UTSW 14 14865404 missense probably damaging 1.00
R5872:Nek10 UTSW 14 14850896 missense probably benign 0.06
R5939:Nek10 UTSW 14 14931290 missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14865633 missense probably benign 0.41
R6235:Nek10 UTSW 14 14821113 nonsense probably null
R6539:Nek10 UTSW 14 14860789 missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14999108 missense probably benign 0.44
R6561:Nek10 UTSW 14 14828448 missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14861684 missense probably benign 0.29
R7039:Nek10 UTSW 14 14826946 missense possibly damaging 0.63
R7039:Nek10 UTSW 14 14986700 missense probably damaging 0.99
R7102:Nek10 UTSW 14 14828517 missense probably damaging 1.00
R7185:Nek10 UTSW 14 14846621 missense probably benign 0.03
R7198:Nek10 UTSW 14 14850947 missense probably damaging 0.99
R7202:Nek10 UTSW 14 14836171 missense probably benign 0.01
R7251:Nek10 UTSW 14 14853965 missense probably benign
R7345:Nek10 UTSW 14 14955503 missense probably benign
R7590:Nek10 UTSW 14 15006693 makesense probably null
R7593:Nek10 UTSW 14 14826955 missense probably benign 0.04
R7616:Nek10 UTSW 14 14937759 missense probably benign 0.27
R7635:Nek10 UTSW 14 14850932 missense probably benign 0.01
R7817:Nek10 UTSW 14 15001017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTGTTTACTAGGATCCACGG -3'
(R):5'- ACTCAGTGTATCTCCAACTGCTG -3'

Sequencing Primer
(F):5'- TGTTTACTAGGATCCACGGAACCC -3'
(R):5'- TGCTGCCTCAGTGAACAAG -3'
Posted On2014-12-04