Incidental Mutation 'R2568:Krt83'
ID254659
Institutional Source Beutler Lab
Gene Symbol Krt83
Ensembl Gene ENSMUSG00000047641
Gene Namekeratin 83
SynonymsKrt2-25
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101431490-101438804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101487827 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 296 (R296S)
Ref Sequence ENSEMBL: ENSMUSP00000023718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023718
AA Change: R296S

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023718
Gene: ENSMUSG00000067613
AA Change: R296S

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 100 5.9e-16 PFAM
Filament 103 414 7.02e-149 SMART
low complexity region 422 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Krt83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Krt83 APN 15 101488211 missense probably benign 0.17
IGL01315:Krt83 APN 15 101486967 splice site probably benign
IGL01702:Krt83 APN 15 101491218 missense probably benign 0.18
IGL02123:Krt83 APN 15 101487585 missense possibly damaging 0.49
IGL02353:Krt83 APN 15 101485458 missense probably benign
IGL02360:Krt83 APN 15 101485458 missense probably benign
IGL02395:Krt83 APN 15 101487952 missense probably benign 0.18
IGL02633:Krt83 APN 15 101491214 missense probably damaging 1.00
R0357:Krt83 UTSW 15 101487019 missense probably benign 0.17
R0650:Krt83 UTSW 15 101487040 missense probably damaging 0.99
R0928:Krt83 UTSW 15 101491280 missense probably benign 0.00
R1126:Krt83 UTSW 15 101487482 missense probably damaging 0.98
R1196:Krt83 UTSW 15 101491433 missense probably benign 0.03
R1252:Krt83 UTSW 15 101487830 missense probably damaging 1.00
R1513:Krt83 UTSW 15 101489657 missense probably benign 0.30
R1612:Krt83 UTSW 15 101488211 missense probably benign 0.17
R1870:Krt83 UTSW 15 101487190 missense probably benign
R2173:Krt83 UTSW 15 101487937 missense probably damaging 0.98
R2432:Krt83 UTSW 15 101488156 nonsense probably null
R2696:Krt83 UTSW 15 101487009 missense probably benign 0.01
R3508:Krt83 UTSW 15 101488158 missense probably benign 0.04
R4364:Krt83 UTSW 15 101487514 missense probably benign
R4366:Krt83 UTSW 15 101487514 missense probably benign
R4606:Krt83 UTSW 15 101487049 missense probably benign 0.18
R4721:Krt83 UTSW 15 101487982 missense probably damaging 1.00
R4784:Krt83 UTSW 15 101487956 missense probably damaging 1.00
R4987:Krt83 UTSW 15 101487009 missense probably benign
R5008:Krt83 UTSW 15 101491224 missense probably damaging 1.00
R5101:Krt83 UTSW 15 101487510 missense probably benign 0.14
R5367:Krt83 UTSW 15 101486994 missense probably damaging 1.00
R5516:Krt83 UTSW 15 101487121 nonsense probably null
R5949:Krt83 UTSW 15 101487595 missense probably damaging 0.99
R5972:Krt83 UTSW 15 101487586 missense probably benign
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6135:Krt83 UTSW 15 101487534 missense probably damaging 1.00
R7151:Krt83 UTSW 15 101489648 missense probably damaging 1.00
R7186:Krt83 UTSW 15 101487202 splice site probably null
R7297:Krt83 UTSW 15 101489647 missense probably benign 0.42
R7708:Krt83 UTSW 15 101487932 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGACATCAACCCAGTGAGC -3'
(R):5'- TCCGTGACTGTGAAGTCCTG -3'

Sequencing Primer
(F):5'- TCAACCCAGTGAGCACAATG -3'
(R):5'- GTTAGGCTGAGCTTTCAAGAAG -3'
Posted On2014-12-04