Mutagenetix > Incidental Mutation

Incidental Mutation 'R1333:Hjurp'

254674

Institutional Source

Beutler Lab

Gene Symbol

Hjurp

Ensembl Gene

ENSMUSG00000044783

Gene Name

Holliday junction recognition protein

Synonyms

MMRRC Submission

039398-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R1333 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88262471-88277633 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 88266046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 380 (V380G)

Ref Sequence

ENSEMBL: ENSMUSP00000054263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000054674
AA Change: V380G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783
AA Change: V380G

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065420
AA Change: V304G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783
AA Change: V304G

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	2.9e-11	PFAM
low complexity region	83	99	N/A	INTRINSIC
low complexity region	139	156	N/A	INTRINSIC
Pfam:HJURP_mid	178	295	7.4e-64	PFAM
Pfam:HJURP_C	309	371	1.2e-26	PFAM
low complexity region	420	439	N/A	INTRINSIC
Pfam:HJURP_C	451	510	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128532

Predicted Effect

probably benign
Transcript: ENSMUST00000147393

SMART Domains

Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	7.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148384

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 90.3%

Validation Efficiency

98% (41/42)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	A	G	8: 113,705,173		probably benign	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
Amt	A	G	9: 108,301,097	D301G	probably benign	Het
Arhgef26	T	C	3: 62,340,323	V276A	probably benign	Het
Bid	C	T	6: 120,897,255	A110T	possibly damaging	Het
Ccdc63	T	C	5: 122,108,161	T566A	probably benign	Het
Cdk5rap1	A	G	2: 154,360,654	S219P	probably damaging	Het
Col1a2	T	A	6: 4,515,684		probably null	Het
Ctns	G	A	11: 73,184,997	T342I	probably benign	Het
Dst	G	A	1: 34,228,347	E4957K	probably damaging	Het
Fam163b	A	G	2: 27,113,647		probably benign	Het
Frem2	T	C	3: 53,549,731	T2067A	probably benign	Het
Gm7353	C	T	7: 3,109,066		noncoding transcript	Het
Gm9791	T	C	3: 34,005,076		noncoding transcript	Het
Grik2	G	T	10: 49,527,991	T258N	probably damaging	Het
Herc3	T	C	6: 58,887,493	L704P	probably damaging	Het
Ikbkap	C	T	4: 56,770,969		probably benign	Het
Lrrc56	A	G	7: 141,198,264		probably benign	Het
Mast3	G	A	8: 70,781,294	P187S	probably damaging	Het
Mier2	A	G	10: 79,545,157	V231A	probably benign	Het
Muc5b	A	G	7: 141,868,407	T4427A	possibly damaging	Het
Nox4	A	G	7: 87,246,864	S7G	possibly damaging	Het
Obscn	G	C	11: 59,080,317	Q2457E	probably damaging	Het
Sh3bgrl2	C	T	9: 83,577,631		probably benign	Het
Slc1a1	A	G	19: 28,835,211		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stat6	G	C	10: 127,651,225	R200S	possibly damaging	Het
Stxbp5l	C	A	16: 37,247,869		probably null	Het
Tanc1	A	G	2: 59,843,491	S1647G	probably benign	Het
Tmem132d	T	A	5: 127,784,859	M733L	probably benign	Het
Unc13d	A	G	11: 116,073,555		probably benign	Het
Usp24	T	C	4: 106,342,353	S165P	possibly damaging	Het
Vmn1r9	T	C	6: 57,071,630	I230T	probably damaging	Het
Zscan20	T	C	4: 128,588,096	D591G	possibly damaging	Het

Other mutations in Hjurp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Hjurp	APN	1	88270269	missense	probably benign	0.04
IGL03099:Hjurp	APN	1	88266289	missense	probably benign	0.09
BB003:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
IGL03097:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03098:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03147:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
PIT4131001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
PIT4142001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
PIT4378001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
PIT4812001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R0053:Hjurp	UTSW	1	88277215	splice site	probably benign
R0371:Hjurp	UTSW	1	88277368	splice site	probably benign
R0442:Hjurp	UTSW	1	88266524	nonsense	probably null
R0762:Hjurp	UTSW	1	88277215	splice site	probably benign
R0928:Hjurp	UTSW	1	88266524	nonsense	probably null
R1342:Hjurp	UTSW	1	88277368	splice site	probably benign
R1364:Hjurp	UTSW	1	88266525	frame shift	probably null
R1496:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R1637:Hjurp	UTSW	1	88266121	missense	probably benign	0.03
R1905:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
R1965:Hjurp	UTSW	1	88266524	nonsense	probably null
R1992:Hjurp	UTSW	1	88266524	nonsense	probably null
R2002:Hjurp	UTSW	1	88266524	nonsense	probably null
R2023:Hjurp	UTSW	1	88266524	nonsense	probably null
R2024:Hjurp	UTSW	1	88266524	nonsense	probably null
R2332:Hjurp	UTSW	1	88277215	splice site	probably benign
R2420:Hjurp	UTSW	1	88266524	nonsense	probably null
R2422:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R2869:Hjurp	UTSW	1	88266524	nonsense	probably null
R2870:Hjurp	UTSW	1	88266524	nonsense	probably null
R2871:Hjurp	UTSW	1	88266524	nonsense	probably null
R2872:Hjurp	UTSW	1	88266524	nonsense	probably null
R3019:Hjurp	UTSW	1	88266524	nonsense	probably null
R3021:Hjurp	UTSW	1	88266524	nonsense	probably null
R3150:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R3411:Hjurp	UTSW	1	88266524	nonsense	probably null
R3552:Hjurp	UTSW	1	88266524	nonsense	probably null
R3704:Hjurp	UTSW	1	88277215	splice site	probably benign
R3730:Hjurp	UTSW	1	88266524	nonsense	probably null
R3733:Hjurp	UTSW	1	88266524	nonsense	probably null
R3764:Hjurp	UTSW	1	88266524	nonsense	probably null
R3799:Hjurp	UTSW	1	88277215	splice site	probably benign
R3819:Hjurp	UTSW	1	88277215	splice site	probably benign
R3857:Hjurp	UTSW	1	88266524	nonsense	probably null
R3930:Hjurp	UTSW	1	88266524	nonsense	probably null
R3952:Hjurp	UTSW	1	88277215	splice site	probably benign
R4090:Hjurp	UTSW	1	88277215	splice site	probably benign
R4159:Hjurp	UTSW	1	88277215	splice site	probably benign
R4207:Hjurp	UTSW	1	88277215	splice site	probably benign
R4322:Hjurp	UTSW	1	88277215	splice site	probably benign
R4391:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4392:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4397:Hjurp	UTSW	1	88266524	nonsense	probably null
R4700:Hjurp	UTSW	1	88266524	nonsense	probably null
R4808:Hjurp	UTSW	1	88277215	splice site	probably benign
R4900:Hjurp	UTSW	1	88266524	nonsense	probably null
R4901:Hjurp	UTSW	1	88266524	nonsense	probably null
R5023:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5024:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5076:Hjurp	UTSW	1	88266524	nonsense	probably null
R5123:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5236:Hjurp	UTSW	1	88266524	nonsense	probably null
R5300:Hjurp	UTSW	1	88266524	nonsense	probably null
R5318:Hjurp	UTSW	1	88266524	nonsense	probably null
R5370:Hjurp	UTSW	1	88266524	nonsense	probably null
R5410:Hjurp	UTSW	1	88266524	nonsense	probably null
R5445:Hjurp	UTSW	1	88266316	missense	probably benign	0.43
R5457:Hjurp	UTSW	1	88266525	frame shift	probably null
R5497:Hjurp	UTSW	1	88266320	missense	possibly damaging	0.92
R5560:Hjurp	UTSW	1	88266524	nonsense	probably null
R5561:Hjurp	UTSW	1	88266524	nonsense	probably null
R5615:Hjurp	UTSW	1	88266524	nonsense	probably null
R5661:Hjurp	UTSW	1	88277215	splice site	probably benign
R5722:Hjurp	UTSW	1	88266524	nonsense	probably null
R6087:Hjurp	UTSW	1	88266524	nonsense	probably null
R6089:Hjurp	UTSW	1	88266524	nonsense	probably null
R6090:Hjurp	UTSW	1	88266524	nonsense	probably null
R6125:Hjurp	UTSW	1	88266524	nonsense	probably null
R6175:Hjurp	UTSW	1	88266524	nonsense	probably null
R6362:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R6659:Hjurp	UTSW	1	88266524	nonsense	probably null
R7016:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7016:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7045:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7179:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7200:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7463:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7912:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R8215:Hjurp	UTSW	1	88266524	nonsense	probably null
R8968:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9038:Hjurp	UTSW	1	88266524	nonsense	probably null
R9115:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9133:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R9146:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9221:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9475:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9482:Hjurp	UTSW	1	88266274	utr 3 prime	probably benign
R9565:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9599:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
V5622:Hjurp	UTSW	1	88277525	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATCGACAGCCCAAGACTCTGTG -3'
(R):5'- GCTCAAAGCCATCCTGCATCATCTC -3'

Sequencing Primer
(F):5'- CTGTGGGGTCAGTCAGGC -3'
(R):5'- TCAACCAGAGCTGGAAGC -3'

Posted On

2014-12-05