Incidental Mutation 'R1488:Arhgap23'
ID254678
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1488 (G1)
Quality Score61
Status Validated
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97500859 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1401 (S1401G)
Ref Sequence ENSEMBL: ENSMUSP00000112999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056955] [ENSMUST00000093940] [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]
Predicted Effect probably benign
Transcript: ENSMUST00000056955
SMART Domains Protein: ENSMUSP00000060323
Gene: ENSMUSG00000047988

DomainStartEndE-ValueType
low complexity region 77 100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093940
AA Change: S238G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091472
Gene: ENSMUSG00000049807
AA Change: S238G

DomainStartEndE-ValueType
Blast:RhoGAP 72 123 3e-6 BLAST
low complexity region 149 162 N/A INTRINSIC
low complexity region 173 194 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107601
AA Change: S1190G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: S1190G

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121799
AA Change: S1401G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: S1401G

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142465
SMART Domains Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
PH 179 300 3.2e-12 SMART
low complexity region 379 387 N/A INTRINSIC
RhoGAP 407 584 6.83e-65 SMART
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0091:Arhgap23 UTSW 11 97452244 missense probably benign 0.44
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0580:Arhgap23 UTSW 11 97446536 frame shift probably null
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R1977:Arhgap23 UTSW 11 97451447 missense possibly damaging 0.95
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R2853:Arhgap23 UTSW 11 97492594 splice site probably null
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7202:Arhgap23 UTSW 11 97451993 missense possibly damaging 0.65
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
R7345:Arhgap23 UTSW 11 97466478 missense possibly damaging 0.91
R7599:Arhgap23 UTSW 11 97500343 missense probably benign
RF020:Arhgap23 UTSW 11 97463561 missense probably damaging 1.00
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCATGCCATGCGACACTCTG -3'
(R):5'- CGGTTCTTCATCCAAGGGACATGAC -3'

Sequencing Primer
(F):5'- ATGCGACACTCTGGCACG -3'
(R):5'- TCCCCAGATGGCAGTGATG -3'
Posted On2014-12-05