Incidental Mutation 'R1350:Col13a1'
ID254691
Institutional Source Beutler Lab
Gene Symbol Col13a1
Ensembl Gene ENSMUSG00000058806
Gene Namecollagen, type XIII, alpha 1
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1350 (G1)
Quality Score23
Status Validated
Chromosome10
Chromosomal Location61838236-61979108 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 61894069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105452] [ENSMUST00000105453] [ENSMUST00000105454]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051826
Predicted Effect probably benign
Transcript: ENSMUST00000105452
SMART Domains Protein: ENSMUSP00000101092
Gene: ENSMUSG00000058806

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
Pfam:Collagen 154 214 1.6e-12 PFAM
Pfam:Collagen 255 319 1.8e-10 PFAM
Pfam:Collagen 283 338 7.8e-11 PFAM
Pfam:Collagen 313 376 6.8e-10 PFAM
Pfam:Collagen 377 436 3e-10 PFAM
Pfam:Collagen 458 517 4.3e-12 PFAM
Pfam:Collagen 498 559 7.7e-12 PFAM
Pfam:Collagen 557 616 1.6e-11 PFAM
Pfam:Collagen 587 666 9.8e-8 PFAM
Pfam:Collagen 635 704 4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105453
SMART Domains Protein: ENSMUSP00000101093
Gene: ENSMUSG00000058806

DomainStartEndE-ValueType
internal_repeat_5 17 30 7.25e-5 PROSPERO
low complexity region 41 59 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
internal_repeat_5 140 153 7.25e-5 PROSPERO
Pfam:Collagen 154 214 1.5e-12 PFAM
Pfam:Collagen 235 296 1e-10 PFAM
internal_repeat_2 297 328 1.33e-8 PROSPERO
internal_repeat_1 297 332 1.43e-12 PROSPERO
Pfam:Collagen 355 414 2.8e-10 PFAM
Pfam:Collagen 436 495 4.6e-12 PFAM
Pfam:Collagen 477 551 3.6e-8 PFAM
Pfam:Collagen 536 606 5.1e-10 PFAM
Pfam:Collagen 574 670 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105454
SMART Domains Protein: ENSMUSP00000101094
Gene: ENSMUSG00000058806

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
Pfam:Collagen 112 161 6.7e-9 PFAM
Pfam:Collagen 164 223 1.5e-11 PFAM
Pfam:Collagen 264 328 6.7e-10 PFAM
Pfam:Collagen 292 347 2.8e-10 PFAM
Pfam:Collagen 322 385 2.3e-9 PFAM
Pfam:Collagen 386 445 1.1e-9 PFAM
Pfam:Collagen 467 526 1.6e-11 PFAM
Pfam:Collagen 507 582 4.8e-9 PFAM
Pfam:Collagen 564 630 5.4e-9 PFAM
low complexity region 671 695 N/A INTRINSIC
internal_repeat_2 698 723 7.38e-7 PROSPERO
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of one of the nonfibrillar collagens. The function of this gene product is not known, however, it has been detected at low levels in all connective tissue-producing cells so it may serve a general function in connective tissues. Unlike most of the collagens, which are secreted into the extracellular matrix, collagen XIII contains a transmembrane domain and the protein has been localized to the plasma membrane. The transcripts for this gene undergo complex and extensive splicing involving at least eight exons. Like other collagens, collagen XIII is a trimer; it is not known whether this trimer is composed of one or more than one alpha chain isomer. A number of alternatively spliced transcript variants have been described, but the full length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the transmembrane exhibit small muscle fibers and are susceptible to excerise-induced muscle damage and muscle inflammation. Mice homozygous for a knock-out allele exhibit tremors and abnormal neuromuscular junction morphology and endplate potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Hepacam2 G A 6: 3,467,530 Q384* probably null Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Col13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Col13a1 APN 10 61864005 critical splice acceptor site probably null
IGL00936:Col13a1 APN 10 61876290 missense probably damaging 0.99
IGL00963:Col13a1 APN 10 61838697 utr 3 prime probably benign
IGL01801:Col13a1 APN 10 61843614 missense probably damaging 1.00
IGL02247:Col13a1 APN 10 61961345 missense probably damaging 1.00
IGL02296:Col13a1 APN 10 61862025 intron probably benign
IGL02430:Col13a1 APN 10 61874751 missense probably benign 0.26
IGL02884:Col13a1 APN 10 61905285 splice site probably benign
IGL03036:Col13a1 APN 10 61893913 critical splice donor site probably null
IGL03145:Col13a1 APN 10 61891261 missense probably benign 0.07
IGL03392:Col13a1 APN 10 61885711 missense possibly damaging 0.88
R0027:Col13a1 UTSW 10 61850161 missense unknown
R0440:Col13a1 UTSW 10 61867483 missense possibly damaging 0.85
R0518:Col13a1 UTSW 10 61862746 missense unknown
R0521:Col13a1 UTSW 10 61862746 missense unknown
R0631:Col13a1 UTSW 10 61887350 nonsense probably null
R1311:Col13a1 UTSW 10 61864010 splice site probably benign
R1572:Col13a1 UTSW 10 61866426 splice site probably null
R2401:Col13a1 UTSW 10 61851162 missense unknown
R2883:Col13a1 UTSW 10 61978356 missense probably benign 0.23
R2906:Col13a1 UTSW 10 61860488 intron probably benign
R2964:Col13a1 UTSW 10 61961331 missense probably damaging 1.00
R2965:Col13a1 UTSW 10 61961331 missense probably damaging 1.00
R3703:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3704:Col13a1 UTSW 10 61867829 critical splice donor site probably null
R3844:Col13a1 UTSW 10 61850209 missense unknown
R3928:Col13a1 UTSW 10 61867525 unclassified probably benign
R3939:Col13a1 UTSW 10 61863082 missense unknown
R4327:Col13a1 UTSW 10 61863979 missense unknown
R4328:Col13a1 UTSW 10 61863979 missense unknown
R4329:Col13a1 UTSW 10 61863979 missense unknown
R4585:Col13a1 UTSW 10 61887245 splice site probably null
R4705:Col13a1 UTSW 10 61850165 missense unknown
R4864:Col13a1 UTSW 10 61862660 missense unknown
R5072:Col13a1 UTSW 10 61874018 splice site silent
R5074:Col13a1 UTSW 10 61874018 splice site silent
R5114:Col13a1 UTSW 10 61890101 missense possibly damaging 0.82
R5625:Col13a1 UTSW 10 61843609 missense unknown
R5664:Col13a1 UTSW 10 61851116 missense probably damaging 1.00
R5799:Col13a1 UTSW 10 61849140 intron probably benign
Z1177:Col13a1 UTSW 10 61905262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCTTTCTGCCTGACAGGAAAC -3'
(R):5'- GTGTGTCTTCAGCACTAGCCTACC -3'

Sequencing Primer
(F):5'- CCTGACAGGAAACCTCAGTGG -3'
(R):5'- GCTTTGGGACATTCTGGGAA -3'
Posted On2014-12-09