Incidental Mutation 'R1648:Rtkn'
ID254695
Institutional Source Beutler Lab
Gene Symbol Rtkn
Ensembl Gene ENSMUSG00000034930
Gene Namerhotekin
Synonyms
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R1648 (G1)
Quality Score20
Status Validated
Chromosome6
Chromosomal Location83135463-83152579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83135994 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 16 (S16P)
Ref Sequence ENSEMBL: ENSMUSP00000065571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065512] [ENSMUST00000087938] [ENSMUST00000121093] [ENSMUST00000135490]
Predicted Effect probably damaging
Transcript: ENSMUST00000065512
AA Change: S16P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065571
Gene: ENSMUSG00000034930
AA Change: S16P

DomainStartEndE-ValueType
Hr1 36 99 5.65e-13 SMART
Pfam:Anillin 117 270 8.3e-46 PFAM
PH 310 418 2.3e-4 SMART
low complexity region 490 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087938
SMART Domains Protein: ENSMUSP00000085249
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121093
SMART Domains Protein: ENSMUSP00000112501
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135490
SMART Domains Protein: ENSMUSP00000116964
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 2e-25 BLAST
Pfam:Anillin 66 221 1.8e-25 PFAM
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that interacts with GTP-bound Rho proteins. Binding of this protein inhibits the GTPase activity of Rho proteins. This protein may interfere with the conversion of active, GTP-bound Rho to the inactive GDP-bound form by RhoGAP. Rho proteins regulate many important cellular processes, including cytokinesis, transcription, smooth muscle contraction, cell growth and transformation. Dysregulation of the Rho signal transduction pathway has been implicated in many forms of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Rtkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Rtkn APN 6 83146061 missense probably damaging 1.00
IGL02265:Rtkn APN 6 83147542 missense probably damaging 1.00
IGL02551:Rtkn APN 6 83151924 missense probably damaging 1.00
IGL03028:Rtkn APN 6 83147872 nonsense probably null
IGL03388:Rtkn APN 6 83150090 missense probably benign 0.02
R2100:Rtkn UTSW 6 83149560 unclassified probably null
R2517:Rtkn UTSW 6 83147545 missense probably damaging 1.00
R3608:Rtkn UTSW 6 83150035 missense probably damaging 0.97
R3946:Rtkn UTSW 6 83135976 missense probably benign 0.01
R4170:Rtkn UTSW 6 83142395 start codon destroyed probably null
R4630:Rtkn UTSW 6 83152182 nonsense probably null
R5044:Rtkn UTSW 6 83150991 missense probably benign 0.01
R5102:Rtkn UTSW 6 83149773 missense probably damaging 0.98
R6165:Rtkn UTSW 6 83145963 missense probably damaging 1.00
R6372:Rtkn UTSW 6 83151901 missense possibly damaging 0.96
R7101:Rtkn UTSW 6 83150012 missense possibly damaging 0.76
R7155:Rtkn UTSW 6 83149711 missense probably damaging 0.99
R7251:Rtkn UTSW 6 83135962 missense probably damaging 1.00
R7381:Rtkn UTSW 6 83151745 missense probably damaging 0.97
R7598:Rtkn UTSW 6 83147903 missense probably null 0.96
R7624:Rtkn UTSW 6 83152177 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCCAGCCGAAAGGATGGAAGCTC -3'
(R):5'- ACCAGGCAAGGCATGGCTTATAC -3'

Sequencing Primer
(F):5'- TGCCTCTGGCAATGAAACTG -3'
(R):5'- TGGCTTATACAGATCAGATGGACC -3'
Posted On2014-12-10