Incidental Mutation 'R1592:Adamts8'
ID254715
Institutional Source Beutler Lab
Gene Symbol Adamts8
Ensembl Gene ENSMUSG00000031994
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
SynonymsMETH-2, METH2
MMRRC Submission 039629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1592 (G1)
Quality Score47
Status Validated
Chromosome9
Chromosomal Location30942562-30963838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30943176 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 114 (S114P)
Ref Sequence ENSEMBL: ENSMUSP00000069644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]
Predicted Effect probably damaging
Transcript: ENSMUST00000068135
AA Change: S114P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: S114P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 152 6.4e-23 PFAM
Pfam:Reprolysin_5 232 418 1.3e-15 PFAM
Pfam:Reprolysin_4 233 435 3.4e-8 PFAM
Pfam:Reprolysin 234 444 3.8e-21 PFAM
Pfam:Reprolysin_2 252 434 1.3e-10 PFAM
Pfam:Reprolysin_3 255 389 7.4e-14 PFAM
TSP1 545 597 7.04e-14 SMART
Pfam:ADAM_spacer1 706 825 3.2e-35 PFAM
TSP1 851 904 5.35e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163037
SMART Domains Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994

DomainStartEndE-ValueType
PDB:2V4B|B 22 128 2e-38 PDB
SCOP:d1kufa_ 27 128 2e-22 SMART
Meta Mutation Damage Score 0.3836 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,645,381 E327G probably damaging Het
Acp5 A T 9: 22,127,851 W189R probably damaging Het
Alkbh3 A C 2: 94,008,424 probably null Het
Ankrd13d T C 19: 4,282,891 H27R probably benign Het
Aox2 A G 1: 58,300,694 N382S probably benign Het
Aspg G A 12: 112,119,972 R220Q probably benign Het
Atg16l2 C A 7: 101,291,986 G403V probably damaging Het
Bcat1 G T 6: 145,010,058 Q299K probably benign Het
Cc2d1b C T 4: 108,626,671 probably benign Het
Cdh26 T C 2: 178,449,891 F81S probably damaging Het
Cnbd2 A G 2: 156,335,402 I222M probably benign Het
Ephb3 T C 16: 21,221,700 V562A probably damaging Het
Fam186a T C 15: 99,940,318 T2682A probably benign Het
Fat2 T C 11: 55,291,870 probably null Het
Fat4 A T 3: 39,007,177 D4303V probably damaging Het
Fbln1 T A 15: 85,231,464 S234T probably benign Het
Gldc G A 19: 30,160,677 probably benign Het
Gli1 A C 10: 127,331,329 V685G probably damaging Het
H2-T22 T C 17: 36,041,577 N152S probably damaging Het
Inpp5d A T 1: 87,665,532 D118V possibly damaging Het
Ints10 A G 8: 68,802,903 I182V possibly damaging Het
Ipcef1 C T 10: 6,935,182 probably null Het
Kcnj3 G T 2: 55,437,886 R229L probably damaging Het
Klf11 C A 12: 24,653,738 D57E probably damaging Het
Krt73 G T 15: 101,802,239 S20* probably null Het
Lactbl1 A G 4: 136,635,876 probably null Het
Mapk10 T C 5: 103,038,621 D45G possibly damaging Het
Mfrp G A 9: 44,103,222 C222Y probably damaging Het
Mga A T 2: 119,964,666 I2944F possibly damaging Het
Msh2 A G 17: 87,680,013 probably null Het
Nckap1l T A 15: 103,482,180 probably null Het
Olfr1034 A G 2: 86,046,989 N169S probably benign Het
Pitpnm1 T A 19: 4,106,964 probably null Het
Sik2 C T 9: 50,995,671 V85I probably damaging Het
Slc26a7 T A 4: 14,552,470 E229V probably benign Het
Spty2d1 A T 7: 46,998,889 D97E possibly damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Uggt1 C A 1: 36,202,858 A332S probably benign Het
Usp53 A T 3: 122,934,050 L961* probably null Het
Vmn1r223 A T 13: 23,249,667 T144S possibly damaging Het
Wdfy1 G A 1: 79,706,255 R388C probably damaging Het
Zfp995 T A 17: 21,887,340 M1L probably damaging Het
Other mutations in Adamts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Adamts8 APN 9 30953500 missense probably damaging 1.00
IGL02049:Adamts8 APN 9 30951354 missense probably damaging 0.96
IGL02304:Adamts8 APN 9 30956656 missense possibly damaging 0.55
IGL02385:Adamts8 APN 9 30961730 missense probably benign 0.10
IGL02536:Adamts8 APN 9 30962072 missense probably benign 0.05
IGL03347:Adamts8 APN 9 30959238 missense possibly damaging 0.75
R0633:Adamts8 UTSW 9 30943511 missense probably damaging 1.00
R1066:Adamts8 UTSW 9 30956541 missense probably damaging 1.00
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1560:Adamts8 UTSW 9 30956667 missense probably damaging 1.00
R1753:Adamts8 UTSW 9 30954614 missense probably benign 0.04
R1932:Adamts8 UTSW 9 30956512 missense probably benign
R2087:Adamts8 UTSW 9 30962112 missense probably damaging 1.00
R2118:Adamts8 UTSW 9 30943063 missense probably damaging 1.00
R3789:Adamts8 UTSW 9 30959292 missense probably damaging 1.00
R4165:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4166:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4193:Adamts8 UTSW 9 30959308 missense probably damaging 1.00
R4425:Adamts8 UTSW 9 30956656 missense possibly damaging 0.55
R5155:Adamts8 UTSW 9 30954548 missense probably benign 0.33
R5433:Adamts8 UTSW 9 30961716 missense probably benign 0.01
R5544:Adamts8 UTSW 9 30952703 missense probably damaging 1.00
R5590:Adamts8 UTSW 9 30951336 missense probably damaging 0.97
R5640:Adamts8 UTSW 9 30956500 missense probably benign 0.00
R5800:Adamts8 UTSW 9 30954482 missense probably damaging 1.00
R5909:Adamts8 UTSW 9 30961928 missense probably benign 0.00
R6821:Adamts8 UTSW 9 30956626 missense probably benign 0.08
R6967:Adamts8 UTSW 9 30954491 missense probably benign 0.04
R7336:Adamts8 UTSW 9 30962067 missense probably benign 0.00
R7538:Adamts8 UTSW 9 30953470 missense probably damaging 1.00
R7540:Adamts8 UTSW 9 30959064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTTCCTGGACAGAGCGGCCC -3'
(R):5'- AAACTTCGGCGGCAGCGAGC -3'

Sequencing Primer
(F):5'- CTCGGAGCTAGTGGTGC -3'
(R):5'- CTGTGGCTGGATGGTGAACT -3'
Posted On2014-12-19