Incidental Mutation 'R1349:Mybph'
ID254716
Institutional Source Beutler Lab
Gene Symbol Mybph
Ensembl Gene ENSMUSG00000042451
Gene Namemyosin binding protein H
Synonyms
MMRRC Submission 039414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1349 (G1)
Quality Score58
Status Validated
Chromosome1
Chromosomal Location134193448-134201232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134193615 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 38 (S38P)
Ref Sequence ENSEMBL: ENSMUSP00000141104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038445] [ENSMUST00000082060] [ENSMUST00000153856] [ENSMUST00000156873] [ENSMUST00000191577]
Predicted Effect probably benign
Transcript: ENSMUST00000038445
AA Change: S38P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451
AA Change: S38P

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082060
SMART Domains Protein: ENSMUSP00000080717
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Glyco_18 30 366 1.2e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134812
Predicted Effect probably benign
Transcript: ENSMUST00000153856
SMART Domains Protein: ENSMUSP00000117117
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 358 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156873
SMART Domains Protein: ENSMUSP00000119205
Gene: ENSMUSG00000064246

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Glyco_18 20 356 1.2e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191577
AA Change: S38P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451
AA Change: S38P

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik G A 8: 124,861,253 T36I possibly damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Ak5 G T 3: 152,533,434 D301E probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Ccdc157 A T 11: 4,149,056 I48N probably benign Het
Cd209d C A 8: 3,878,515 probably benign Het
Cecr2 G A 6: 120,757,603 G613E probably damaging Het
Clspn C T 4: 126,563,977 A98V probably benign Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dbpht2 C CNNNNNNNNNNNNNNNNNN 12: 74,299,062 noncoding transcript Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dmxl1 A T 18: 49,888,853 N1612Y probably damaging Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Frem1 T C 4: 82,922,305 probably benign Het
Glipr1 A G 10: 111,993,532 V108A probably benign Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Gpatch2l T C 12: 86,260,709 L287P possibly damaging Het
Hp T G 8: 109,575,306 K337Q probably benign Het
Htr1a T A 13: 105,445,366 C371* probably null Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Map4k4 C A 1: 40,021,159 P1103Q probably damaging Het
Myo1e T G 9: 70,287,069 probably benign Het
Nefh T TNNNNNNNNNNNNNNNNNN 11: 4,941,010 probably benign Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Slc6a7 C T 18: 61,000,543 G527D probably benign Het
Tgm1 A G 14: 55,711,201 probably benign Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Togaram1 T A 12: 65,011,145 M1502K probably damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vmn2r102 A T 17: 19,660,625 probably benign Het
Vmn2r12 T C 5: 109,086,586 M587V probably benign Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Wdr35 A T 12: 9,019,870 probably benign Het
Wdr73 C A 7: 80,893,252 V176L probably damaging Het
Other mutations in Mybph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Mybph APN 1 134193925 missense probably benign 0.02
IGL02312:Mybph APN 1 134197450 missense probably damaging 0.99
PIT4581001:Mybph UTSW 1 134194741 missense probably benign 0.00
R0055:Mybph UTSW 1 134193852 missense probably damaging 0.99
R0055:Mybph UTSW 1 134193852 missense probably damaging 0.99
R0346:Mybph UTSW 1 134197754 missense probably damaging 1.00
R0669:Mybph UTSW 1 134197343 splice site probably null
R0765:Mybph UTSW 1 134197496 missense possibly damaging 0.78
R1662:Mybph UTSW 1 134193636 missense probably benign 0.01
R1728:Mybph UTSW 1 134197480 missense probably benign 0.00
R1729:Mybph UTSW 1 134197480 missense probably benign 0.00
R1730:Mybph UTSW 1 134197480 missense probably benign 0.00
R1739:Mybph UTSW 1 134197480 missense probably benign 0.00
R1762:Mybph UTSW 1 134197480 missense probably benign 0.00
R1783:Mybph UTSW 1 134197480 missense probably benign 0.00
R1784:Mybph UTSW 1 134197480 missense probably benign 0.00
R1785:Mybph UTSW 1 134197480 missense probably benign 0.00
R1978:Mybph UTSW 1 134196996 missense probably benign 0.01
R2058:Mybph UTSW 1 134200119 missense probably damaging 1.00
R3115:Mybph UTSW 1 134194738 missense probably benign
R4841:Mybph UTSW 1 134198495 missense probably damaging 1.00
R4842:Mybph UTSW 1 134198495 missense probably damaging 1.00
R5208:Mybph UTSW 1 134193535 missense probably benign
R7561:Mybph UTSW 1 134193727 critical splice donor site probably null
R7787:Mybph UTSW 1 134197508 missense probably benign 0.00
R7997:Mybph UTSW 1 134194667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCCTGCCTTTATAAGCATGAACC -3'
(R):5'- ATAGCCTTGAAGCCCCAGTTTGCC -3'

Sequencing Primer
(F):5'- TTATAAGCATGAACCTAGCCTGGAG -3'
(R):5'- GTGGCTCACATCCTCCAAG -3'
Posted On2014-12-19