Mutagenetix > Incidental Mutation

Incidental Mutation 'R2913:Igsf10'

254734

Institutional Source

Beutler Lab

Gene Symbol

Igsf10

Ensembl Gene

ENSMUSG00000036334

Gene Name

immunoglobulin superfamily, member 10

Synonyms

Adlican2, CMF608, 6530405F15Rik

MMRRC Submission

040500-MU

Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R2913 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59316735-59344394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59331736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 341 (L341F)

Ref Sequence

ENSEMBL: ENSMUSP00000141391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546]

AlphaFold

Q3V1M1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039419
AA Change: L341F

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: L341F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193455
AA Change: L341F

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: L341F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194546
AA Change: L341F

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: L341F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (58/58)

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,270,685	S3159P	unknown	Het
5430419D17Rik	T	C	7: 131,182,024	S49P	possibly damaging	Het
9530053A07Rik	A	T	7: 28,164,307	L2501F	probably damaging	Het
Acap2	T	C	16: 31,116,069	Q357R	probably damaging	Het
Adap1	C	T	5: 139,274,821		probably null	Het
Adgrf3	A	G	5: 30,196,994	S679P	probably damaging	Het
Aldh3b1	T	C	19: 3,921,275		probably benign	Het
Arih2	A	G	9: 108,644,076	S68P	probably damaging	Het
Col1a2	C	T	6: 4,519,923		probably benign	Het
Crocc	C	T	4: 141,020,350	R1496H	probably damaging	Het
Cryl1	T	C	14: 57,275,918	E282G	probably benign	Het
Cyp11b1	T	C	15: 74,836,421	T402A	probably damaging	Het
Etfa	C	A	9: 55,482,329	A254S	probably damaging	Het
Fdxacb1	C	T	9: 50,768,399	A39V	probably benign	Het
Fras1	G	A	5: 96,733,915	R2502K	probably benign	Het
Gpr157	G	A	4: 150,098,765	V131I	probably benign	Het
Hbb-bh1	C	T	7: 103,843,047	E22K	possibly damaging	Het
Hmcn2	A	G	2: 31,460,210	T5040A	possibly damaging	Het
Hprt	T	C	X: 53,020,139	Y174H	probably damaging	Het
Ints1	A	G	5: 139,757,913	S1592P	possibly damaging	Het
Itgam	T	C	7: 128,112,406	I641T	probably damaging	Het
Macf1	T	A	4: 123,475,911	I121F	probably damaging	Het
Mapk3	T	A	7: 126,760,806	C19*	probably null	Het
Mapk4	C	T	18: 73,935,165	A232T	probably benign	Het
Med26	T	G	8: 72,496,112	K381T	possibly damaging	Het
Mki67	T	C	7: 135,700,686	E873G	possibly damaging	Het
Mrgpra9	T	C	7: 47,235,080	I280V	probably benign	Het
Mroh9	T	C	1: 163,044,003	Y637C	probably damaging	Het
Nktr	T	C	9: 121,749,604		probably benign	Het
Olfr1052	A	G	2: 86,298,389	D191G	probably damaging	Het
Olfr1206	A	T	2: 88,865,114	N170Y	probably benign	Het
Pam	A	C	1: 97,923,129	L168R	probably damaging	Het
Pikfyve	G	A	1: 65,253,517	V1376M	probably damaging	Het
Pomt2	A	T	12: 87,128,969	N400K	probably damaging	Het
Pramef12	T	C	4: 144,392,734	E421G	probably damaging	Het
Rbm45	C	T	2: 76,375,454	P217S	probably benign	Het
Rc3h2	A	G	2: 37,378,959	S832P	possibly damaging	Het
Ric3	A	G	7: 109,054,453	F144L	possibly damaging	Het
Rrh	G	T	3: 129,815,609	A83E	probably damaging	Het
Rspo2	T	A	15: 43,078,114	T138S	probably benign	Het
Skint5	A	G	4: 113,524,092		probably benign	Het
Snx29	C	T	16: 11,447,453	R516W	probably damaging	Het
Spata31d1d	T	C	13: 59,726,955	E922G	possibly damaging	Het
Spc25	T	C	2: 69,199,987	H104R	probably benign	Het
Sptssa	A	T	12: 54,656,482	M1K	probably null	Het
Srrm2	G	T	17: 23,815,684		probably benign	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tmem181c-ps	A	G	17: 6,621,209		noncoding transcript	Het
Tmprss15	T	C	16: 78,962,190	N880S	probably benign	Het
Trio	T	A	15: 27,854,912	Q728L	probably damaging	Het
Txk	T	C	5: 72,724,451	N154S	probably damaging	Het
Vwf	T	A	6: 125,685,846	V2731E	probably benign	Het
Yes1	T	C	5: 32,640,582	S82P	probably benign	Het
Zgrf1	T	C	3: 127,598,707	V1292A	possibly damaging	Het

Other mutations in Igsf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Igsf10	APN	3	59331539	missense	probably benign	0.03
IGL00790:Igsf10	APN	3	59319517	missense	probably damaging	1.00
IGL00916:Igsf10	APN	3	59331127	missense	probably damaging	0.97
IGL00928:Igsf10	APN	3	59330597	missense	probably benign	0.00
IGL01066:Igsf10	APN	3	59327782	critical splice donor site	probably null
IGL01107:Igsf10	APN	3	59331524	missense	probably damaging	1.00
IGL01420:Igsf10	APN	3	59319650	missense	probably benign	0.02
IGL01533:Igsf10	APN	3	59319230	missense	probably damaging	0.98
IGL01537:Igsf10	APN	3	59330031	missense	probably benign	0.00
IGL01676:Igsf10	APN	3	59326011	missense	probably benign	0.06
IGL01676:Igsf10	APN	3	59329335	missense	probably benign	0.17
IGL01960:Igsf10	APN	3	59318737	missense	probably benign	0.00
IGL02123:Igsf10	APN	3	59318660	missense	probably damaging	0.97
IGL02198:Igsf10	APN	3	59325978	missense	possibly damaging	0.95
IGL02268:Igsf10	APN	3	59331152	nonsense	probably null
IGL02313:Igsf10	APN	3	59330690	missense	probably benign	0.01
IGL02368:Igsf10	APN	3	59328231	missense	probably benign
IGL02494:Igsf10	APN	3	59328006	missense	probably damaging	0.98
IGL02549:Igsf10	APN	3	59329241	missense	probably benign	0.03
IGL02616:Igsf10	APN	3	59318606	missense	probably benign	0.06
IGL02957:Igsf10	APN	3	59330864	missense	probably damaging	1.00
IGL03067:Igsf10	APN	3	59318918	missense	probably benign	0.25
IGL03104:Igsf10	APN	3	59319484	missense	probably damaging	1.00
IGL03124:Igsf10	APN	3	59319665	missense	probably benign	0.01
IGL03212:Igsf10	APN	3	59328165	missense	probably benign	0.09
IGL03347:Igsf10	APN	3	59331900	missense	possibly damaging	0.94
IGL03357:Igsf10	APN	3	59336211	missense	probably benign	0.35
F6893:Igsf10	UTSW	3	59331060	missense	probably damaging	1.00
FR4449:Igsf10	UTSW	3	59319110	missense	probably damaging	1.00
PIT1430001:Igsf10	UTSW	3	59328158	missense	probably benign	0.06
PIT4402001:Igsf10	UTSW	3	59325579	missense	probably benign	0.00
PIT4810001:Igsf10	UTSW	3	59318482	missense	probably damaging	1.00
R0068:Igsf10	UTSW	3	59330624	missense	probably damaging	0.98
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0112:Igsf10	UTSW	3	59326008	missense	probably benign	0.00
R0141:Igsf10	UTSW	3	59330832	missense	probably damaging	1.00
R0538:Igsf10	UTSW	3	59320106	missense	probably damaging	0.99
R0551:Igsf10	UTSW	3	59328668	missense	probably benign	0.01
R0556:Igsf10	UTSW	3	59328875	missense	probably benign	0.02
R0582:Igsf10	UTSW	3	59319767	missense	probably benign	0.00
R0630:Igsf10	UTSW	3	59326062	missense	probably damaging	1.00
R0675:Igsf10	UTSW	3	59328594	missense	probably benign	0.14
R0948:Igsf10	UTSW	3	59331104	missense	probably damaging	1.00
R1252:Igsf10	UTSW	3	59331848	missense	probably benign	0.03
R1412:Igsf10	UTSW	3	59327775	splice site	probably benign
R1473:Igsf10	UTSW	3	59318767	missense	probably damaging	1.00
R1585:Igsf10	UTSW	3	59330417	missense	probably damaging	1.00
R1650:Igsf10	UTSW	3	59326162	missense	probably damaging	1.00
R1660:Igsf10	UTSW	3	59331285	missense	probably damaging	1.00
R1671:Igsf10	UTSW	3	59328500	nonsense	probably null
R1748:Igsf10	UTSW	3	59319093	missense	probably damaging	1.00
R1758:Igsf10	UTSW	3	59329196	missense	probably benign	0.09
R1856:Igsf10	UTSW	3	59331272	missense	possibly damaging	0.63
R1912:Igsf10	UTSW	3	59329572	missense	probably benign	0.40
R2148:Igsf10	UTSW	3	59336577	missense	possibly damaging	0.77
R2155:Igsf10	UTSW	3	59331680	missense	probably damaging	1.00
R2509:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2511:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2680:Igsf10	UTSW	3	59325454	missense	probably benign	0.14
R2927:Igsf10	UTSW	3	59329427	missense	probably benign
R3547:Igsf10	UTSW	3	59330541	missense	probably benign	0.02
R3547:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3548:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3620:Igsf10	UTSW	3	59336331	missense	probably damaging	1.00
R3732:Igsf10	UTSW	3	59325714	missense	probably benign	0.29
R3743:Igsf10	UTSW	3	59326125	missense	possibly damaging	0.69
R3973:Igsf10	UTSW	3	59331924	missense	probably damaging	1.00
R4005:Igsf10	UTSW	3	59328560	missense	probably benign	0.00
R4184:Igsf10	UTSW	3	59319731	missense	probably damaging	1.00
R4302:Igsf10	UTSW	3	59318750	missense	probably damaging	1.00
R4404:Igsf10	UTSW	3	59329551	missense	probably benign	0.04
R4575:Igsf10	UTSW	3	59330100	missense	probably benign
R4676:Igsf10	UTSW	3	59325949	missense	probably benign	0.23
R4700:Igsf10	UTSW	3	59320330	missense	probably damaging	0.99
R4765:Igsf10	UTSW	3	59329705	missense	probably benign	0.01
R4986:Igsf10	UTSW	3	59328606	missense	probably benign	0.24
R5012:Igsf10	UTSW	3	59318722	missense	probably damaging	1.00
R5070:Igsf10	UTSW	3	59328293	missense	probably benign	0.02
R5083:Igsf10	UTSW	3	59326273	missense	probably damaging	1.00
R5336:Igsf10	UTSW	3	59320132	missense	probably damaging	1.00
R5462:Igsf10	UTSW	3	59325754	missense	probably damaging	1.00
R5648:Igsf10	UTSW	3	59328153	missense	probably benign	0.01
R5810:Igsf10	UTSW	3	59319071	missense	probably damaging	1.00
R5871:Igsf10	UTSW	3	59330411	missense	possibly damaging	0.83
R5880:Igsf10	UTSW	3	59330831	missense	probably damaging	1.00
R5935:Igsf10	UTSW	3	59328157	missense	probably benign	0.12
R5979:Igsf10	UTSW	3	59336473	missense	probably damaging	1.00
R6145:Igsf10	UTSW	3	59331656	missense	possibly damaging	0.83
R6222:Igsf10	UTSW	3	59318915	missense	possibly damaging	0.90
R6224:Igsf10	UTSW	3	59325510	missense	probably damaging	1.00
R6264:Igsf10	UTSW	3	59328507	missense	possibly damaging	0.88
R6283:Igsf10	UTSW	3	59319449	missense	probably damaging	1.00
R6336:Igsf10	UTSW	3	59330339	missense	probably benign	0.00
R6490:Igsf10	UTSW	3	59329571	missense	probably benign	0.06
R6785:Igsf10	UTSW	3	59319244	missense	probably damaging	1.00
R6873:Igsf10	UTSW	3	59328444	missense	probably benign
R6889:Igsf10	UTSW	3	59331933	missense	probably benign
R7024:Igsf10	UTSW	3	59331701	missense	probably benign	0.00
R7056:Igsf10	UTSW	3	59331080	missense	probably damaging	1.00
R7128:Igsf10	UTSW	3	59328905	missense	probably benign
R7251:Igsf10	UTSW	3	59319454	missense	probably damaging	1.00
R7313:Igsf10	UTSW	3	59329416	missense	probably benign	0.05
R7340:Igsf10	UTSW	3	59325768	missense	probably damaging	1.00
R7447:Igsf10	UTSW	3	59331801	missense	probably benign	0.39
R7506:Igsf10	UTSW	3	59319354	missense	probably damaging	1.00
R7678:Igsf10	UTSW	3	59319340	missense	possibly damaging	0.81
R7695:Igsf10	UTSW	3	59326191	missense	probably damaging	1.00
R7709:Igsf10	UTSW	3	59331543	missense	probably damaging	0.96
R7749:Igsf10	UTSW	3	59329128	missense	possibly damaging	0.88
R7808:Igsf10	UTSW	3	59328068	missense	probably benign	0.00
R7850:Igsf10	UTSW	3	59319632	missense	probably benign	0.33
R7879:Igsf10	UTSW	3	59330724	missense	probably damaging	1.00
R7886:Igsf10	UTSW	3	59328327	missense	probably benign	0.01
R7891:Igsf10	UTSW	3	59328411	nonsense	probably null
R7946:Igsf10	UTSW	3	59319704	missense	possibly damaging	0.69
R7948:Igsf10	UTSW	3	59331858	missense	probably benign	0.02
R8004:Igsf10	UTSW	3	59329709	missense	probably benign	0.01
R8096:Igsf10	UTSW	3	59328959	missense	probably damaging	0.98
R8141:Igsf10	UTSW	3	59330528	missense	probably damaging	0.96
R8183:Igsf10	UTSW	3	59330615	missense	probably benign	0.04
R8203:Igsf10	UTSW	3	59328833	missense	probably benign	0.11
R8325:Igsf10	UTSW	3	59318533	missense	probably damaging	0.96
R8350:Igsf10	UTSW	3	59331528	missense	probably damaging	1.00
R8387:Igsf10	UTSW	3	59329143	missense	probably damaging	1.00
R8488:Igsf10	UTSW	3	59320010	missense	probably damaging	1.00
R8697:Igsf10	UTSW	3	59318887	missense	probably benign	0.02
R8786:Igsf10	UTSW	3	59330642	missense	probably benign	0.25
R8804:Igsf10	UTSW	3	59336455	missense	probably damaging	1.00
R8886:Igsf10	UTSW	3	59329989	missense	probably benign	0.00
R8902:Igsf10	UTSW	3	59336212	missense	probably benign	0.00
R8906:Igsf10	UTSW	3	59326318	missense	probably benign	0.01
R8917:Igsf10	UTSW	3	59319467	missense	possibly damaging	0.69
R9051:Igsf10	UTSW	3	59329247	missense	probably benign	0.00
R9178:Igsf10	UTSW	3	59326059	missense	possibly damaging	0.69
R9228:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9230:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9231:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9232:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9417:Igsf10	UTSW	3	59329105	missense	possibly damaging	0.94
R9609:Igsf10	UTSW	3	59319448	missense	probably damaging	1.00
R9631:Igsf10	UTSW	3	59330483	missense	probably damaging	1.00
R9689:Igsf10	UTSW	3	59326203	missense	probably damaging	1.00
R9762:Igsf10	UTSW	3	59329685	missense	probably damaging	1.00
R9770:Igsf10	UTSW	3	59319778	missense	probably benign	0.07
R9798:Igsf10	UTSW	3	59331705	missense	probably damaging	1.00
Z1088:Igsf10	UTSW	3	59329938	missense	possibly damaging	0.59
Z1177:Igsf10	UTSW	3	59329605	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCCACCTGTTGATATTTGGG -3'
(R):5'- CTCGTTCCTGTGTACAAAGCC -3'

Sequencing Primer
(F):5'- CCACCTGTTGATATTTGGGAGACAG -3'
(R):5'- TTCCTGTGTACAAAGCCAACCATTG -3'

Posted On

2014-12-29