Incidental Mutation 'R2913:Adgrf3'
ID 254742
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Name adhesion G protein-coupled receptor F3
Synonyms Gpr113, LOC381628, PGR23
MMRRC Submission 040500-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2913 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 30193431-30205722 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30196994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 679 (S679P)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
AlphaFold Q58Y75
Predicted Effect probably damaging
Transcript: ENSMUST00000088117
AA Change: S679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: S679P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114774
AA Change: S679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110422
Gene: ENSMUSG00000067642
AA Change: S679P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
Pfam:DUF3497 417 609 1.1e-12 PFAM
GPS 631 683 2.68e-17 SMART
Pfam:7tm_2 686 934 5.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Meta Mutation Damage Score 0.2988 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,270,685 S3159P unknown Het
5430419D17Rik T C 7: 131,182,024 S49P possibly damaging Het
9530053A07Rik A T 7: 28,164,307 L2501F probably damaging Het
Acap2 T C 16: 31,116,069 Q357R probably damaging Het
Adap1 C T 5: 139,274,821 probably null Het
Aldh3b1 T C 19: 3,921,275 probably benign Het
Arih2 A G 9: 108,644,076 S68P probably damaging Het
Col1a2 C T 6: 4,519,923 probably benign Het
Crocc C T 4: 141,020,350 R1496H probably damaging Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Cyp11b1 T C 15: 74,836,421 T402A probably damaging Het
Etfa C A 9: 55,482,329 A254S probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hbb-bh1 C T 7: 103,843,047 E22K possibly damaging Het
Hmcn2 A G 2: 31,460,210 T5040A possibly damaging Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Igsf10 T A 3: 59,331,736 L341F possibly damaging Het
Ints1 A G 5: 139,757,913 S1592P possibly damaging Het
Itgam T C 7: 128,112,406 I641T probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mapk3 T A 7: 126,760,806 C19* probably null Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Med26 T G 8: 72,496,112 K381T possibly damaging Het
Mki67 T C 7: 135,700,686 E873G possibly damaging Het
Mrgpra9 T C 7: 47,235,080 I280V probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Pam A C 1: 97,923,129 L168R probably damaging Het
Pikfyve G A 1: 65,253,517 V1376M probably damaging Het
Pomt2 A T 12: 87,128,969 N400K probably damaging Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rc3h2 A G 2: 37,378,959 S832P possibly damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Rrh G T 3: 129,815,609 A83E probably damaging Het
Rspo2 T A 15: 43,078,114 T138S probably benign Het
Skint5 A G 4: 113,524,092 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Spata31d1d T C 13: 59,726,955 E922G possibly damaging Het
Spc25 T C 2: 69,199,987 H104R probably benign Het
Sptssa A T 12: 54,656,482 M1K probably null Het
Srrm2 G T 17: 23,815,684 probably benign Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmem181c-ps A G 17: 6,621,209 noncoding transcript Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Trio T A 15: 27,854,912 Q728L probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Vwf T A 6: 125,685,846 V2731E probably benign Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Zgrf1 T C 3: 127,598,707 V1292A possibly damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1695:Adgrf3 UTSW 5 30203555 missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30197314 missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30196524 missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30199512 missense probably damaging 1.00
R8281:Adgrf3 UTSW 5 30197303 missense possibly damaging 0.46
R8717:Adgrf3 UTSW 5 30198581 unclassified probably benign
R8857:Adgrf3 UTSW 5 30197067 nonsense probably null
R8926:Adgrf3 UTSW 5 30200448 missense possibly damaging 0.46
R9391:Adgrf3 UTSW 5 30195073 missense possibly damaging 0.94
R9446:Adgrf3 UTSW 5 30196959 missense probably benign 0.01
R9522:Adgrf3 UTSW 5 30199484 missense possibly damaging 0.90
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGAAGCATGTGTCTGCGACC -3'
(R):5'- GTCTCCATAACAGCAGACGG -3'

Sequencing Primer
(F):5'- AGCAAGCAGATCACCATGTTAAACAG -3'
(R):5'- CTTCACGCAGGCAGAAGTTATCATG -3'
Posted On 2014-12-29