Incidental Mutation 'R2913:Cryl1'
ID254766
Institutional Source Beutler Lab
Gene Symbol Cryl1
Ensembl Gene ENSMUSG00000021947
Gene Namecrystallin, lambda 1
SynonymsA230106J09Rik, 1110025H08Rik
MMRRC Submission 040500-MU
Accession Numbers

Genbank: NM_030004; Ensembl: ENSMUST00000089502

Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R2913 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57274993-57398529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57275918 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 282 (E282G)
Ref Sequence ENSEMBL: ENSMUSP00000022517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022517]
Predicted Effect probably benign
Transcript: ENSMUST00000022517
AA Change: E282G

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022517
Gene: ENSMUSG00000021947
AA Change: E282G

DomainStartEndE-ValueType
Pfam:3HCDH_N 8 190 3.4e-53 PFAM
Pfam:3HCDH 192 282 8.9e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The uronate cycle functions as an alternative glucose metabolic pathway, accounting for about 5% of daily glucose catabolism. The product of this gene catalyzes the dehydrogenation of L-gulonate into dehydro-L-gulonate in the uronate cycle. The enzyme requires NAD(H) as a coenzyme, and is inhibited by inorganic phosphate. A similar gene in the rabbit is thought to serve a structural role in the lens of the eye. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,270,685 S3159P unknown Het
5430419D17Rik T C 7: 131,182,024 S49P possibly damaging Het
9530053A07Rik A T 7: 28,164,307 L2501F probably damaging Het
Acap2 T C 16: 31,116,069 Q357R probably damaging Het
Adap1 C T 5: 139,274,821 probably null Het
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Aldh3b1 T C 19: 3,921,275 probably benign Het
Arih2 A G 9: 108,644,076 S68P probably damaging Het
Col1a2 C T 6: 4,519,923 probably benign Het
Crocc C T 4: 141,020,350 R1496H probably damaging Het
Cyp11b1 T C 15: 74,836,421 T402A probably damaging Het
Etfa C A 9: 55,482,329 A254S probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hbb-bh1 C T 7: 103,843,047 E22K possibly damaging Het
Hmcn2 A G 2: 31,460,210 T5040A possibly damaging Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Igsf10 T A 3: 59,331,736 L341F possibly damaging Het
Ints1 A G 5: 139,757,913 S1592P possibly damaging Het
Itgam T C 7: 128,112,406 I641T probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mapk3 T A 7: 126,760,806 C19* probably null Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Med26 T G 8: 72,496,112 K381T possibly damaging Het
Mki67 T C 7: 135,700,686 E873G possibly damaging Het
Mrgpra9 T C 7: 47,235,080 I280V probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Pam A C 1: 97,923,129 L168R probably damaging Het
Pikfyve G A 1: 65,253,517 V1376M probably damaging Het
Pomt2 A T 12: 87,128,969 N400K probably damaging Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rc3h2 A G 2: 37,378,959 S832P possibly damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Rrh G T 3: 129,815,609 A83E probably damaging Het
Rspo2 T A 15: 43,078,114 T138S probably benign Het
Skint5 A G 4: 113,524,092 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Spata31d1d T C 13: 59,726,955 E922G possibly damaging Het
Spc25 T C 2: 69,199,987 H104R probably benign Het
Sptssa A T 12: 54,656,482 M1K probably null Het
Srrm2 G T 17: 23,815,684 probably benign Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmem181c-ps A G 17: 6,621,209 noncoding transcript Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Trio T A 15: 27,854,912 Q728L probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Vwf T A 6: 125,685,846 V2731E probably benign Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Zgrf1 T C 3: 127,598,707 V1292A possibly damaging Het
Other mutations in Cryl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Cryl1 APN 14 57286364 critical splice donor site probably null
IGL02117:Cryl1 APN 14 57286447 missense probably damaging 1.00
IGL02556:Cryl1 APN 14 57276021 missense probably benign 0.00
IGL02749:Cryl1 APN 14 57303724 missense probably benign 0.03
IGL03108:Cryl1 APN 14 57313077 missense probably damaging 1.00
G5030:Cryl1 UTSW 14 57342138 intron probably benign
R0391:Cryl1 UTSW 14 57303775 missense possibly damaging 0.94
R2087:Cryl1 UTSW 14 57275945 missense possibly damaging 0.84
R2155:Cryl1 UTSW 14 57398423 missense unknown
R2263:Cryl1 UTSW 14 57286408 nonsense probably null
R2914:Cryl1 UTSW 14 57275918 missense probably benign 0.19
R4747:Cryl1 UTSW 14 57313102 missense probably damaging 1.00
R5482:Cryl1 UTSW 14 57313012 missense probably damaging 0.99
R5977:Cryl1 UTSW 14 57382779 missense probably benign 0.02
R6792:Cryl1 UTSW 14 57382767 missense probably damaging 0.97
R7134:Cryl1 UTSW 14 57275499 missense probably benign
R7409:Cryl1 UTSW 14 57286385 missense probably damaging 1.00
R7522:Cryl1 UTSW 14 57275971 missense probably benign
R7653:Cryl1 UTSW 14 57303691 missense probably benign 0.01
R7711:Cryl1 UTSW 14 57275556 missense probably benign 0.01
R7785:Cryl1 UTSW 14 57275481 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGTCAAAACGAGCTGCTGG -3'
(R):5'- CCCAGGATAGACTCTTCTGCAG -3'

Sequencing Primer
(F):5'- GCTGGTCGCCATCACCTTG -3'
(R):5'- CTTCTGCAGAGGTCTCAGCTG -3'
Posted On2014-12-29