Incidental Mutation 'R0318:Mapkapk2'
ID25477
Institutional Source Beutler Lab
Gene Symbol Mapkapk2
Ensembl Gene ENSMUSG00000016528
Gene NameMAP kinase-activated protein kinase 2
SynonymsMAPKAP kinase 2, Rps6kc1, MK2
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0318 (G1)
Quality Score195
Status Not validated
Chromosome1
Chromosomal Location131053700-131097826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131097335 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 64 (V64A)
Ref Sequence ENSEMBL: ENSMUSP00000016672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016672]
Predicted Effect probably damaging
Transcript: ENSMUST00000016672
AA Change: V64A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016672
Gene: ENSMUSG00000016528
AA Change: V64A

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
S_TKc 50 311 1.26e-93 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus affects the inflammatory response. Homozygous null mice show an increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
Blk A G 14: 63,374,197 Y430H probably damaging Het
C3 C T 17: 57,224,709 V272M probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Chaf1a C T 17: 56,062,227 T486I possibly damaging Het
Colec12 A G 18: 9,848,446 N208S possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr995 C A 2: 85,438,237 R307M possibly damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Smg9 T C 7: 24,420,888 F429S possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Veph1 G T 3: 66,057,259 S783Y probably damaging Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in Mapkapk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Mapkapk2 APN 1 131058762 start codon destroyed probably null
R0015:Mapkapk2 UTSW 1 131097326 missense possibly damaging 0.79
R1234:Mapkapk2 UTSW 1 131055776 nonsense probably null
R1755:Mapkapk2 UTSW 1 131058350 critical splice donor site probably null
R1765:Mapkapk2 UTSW 1 131058761 start codon destroyed probably null 0.09
R3907:Mapkapk2 UTSW 1 131056914 missense probably damaging 1.00
R5949:Mapkapk2 UTSW 1 131058005 missense possibly damaging 0.95
R6838:Mapkapk2 UTSW 1 131058003 nonsense probably null
R7445:Mapkapk2 UTSW 1 131097519 missense unknown
R7802:Mapkapk2 UTSW 1 131056902 missense possibly damaging 0.51
R7839:Mapkapk2 UTSW 1 131097519 missense unknown
R7922:Mapkapk2 UTSW 1 131097519 missense unknown
RF002:Mapkapk2 UTSW 1 131056513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGGCAGTCCCCGTGAGTC -3'
(R):5'- ATGTCCACGCCTCCCAGTCAAG -3'

Sequencing Primer
(F):5'- TGAGTCCTCTCGGGTGC -3'
(R):5'- GAGCAAACTTcgccgcc -3'
Posted On2013-04-16