Incidental Mutation 'R2914:Mael'
ID254784
Institutional Source Beutler Lab
Gene Symbol Mael
Ensembl Gene ENSMUSG00000040629
Gene Namemaelstrom spermatogenic transposon silencer
Synonyms4933405K18Rik
MMRRC Submission 040501-MU
Accession Numbers

Genbank: NM_175296; MGI: 2138453

Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location166201201-166238747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 166226610 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 188 (F188I)
Ref Sequence ENSEMBL: ENSMUSP00000141652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038782] [ENSMUST00000194057]
Predicted Effect probably damaging
Transcript: ENSMUST00000038782
AA Change: F202I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045828
Gene: ENSMUSG00000040629
AA Change: F202I

DomainStartEndE-ValueType
Pfam:HMG_box_2 2 73 4.4e-27 PFAM
Pfam:Maelstrom 128 329 1.6e-58 PFAM
low complexity region 399 407 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194057
AA Change: F188I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141652
Gene: ENSMUSG00000040629
AA Change: F188I

DomainStartEndE-ValueType
Pfam:HMG_box_2 2 73 1.6e-24 PFAM
Pfam:Maelstrom 128 314 2.6e-43 PFAM
low complexity region 385 393 N/A INTRINSIC
Meta Mutation Damage Score 0.4467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele are infertile and display small testes, a complete block of spermatogenesis due to apoptosis during meiotic prophase I, defects in homologous chromosome synapsis, DNA damage, reduced DNA methylation, and derepression of L1 retrotransposons in the adult testis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Mael
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Mael APN 1 166204849 missense probably damaging 1.00
IGL01153:Mael APN 1 166202350 missense possibly damaging 0.89
D4043:Mael UTSW 1 166236886 missense probably benign 0.00
R0218:Mael UTSW 1 166238590 missense probably damaging 1.00
R0811:Mael UTSW 1 166235399 critical splice donor site probably null
R0812:Mael UTSW 1 166235399 critical splice donor site probably null
R1544:Mael UTSW 1 166202290 missense probably benign 0.28
R2096:Mael UTSW 1 166225675 missense probably benign 0.41
R3031:Mael UTSW 1 166204806 missense probably damaging 1.00
R3709:Mael UTSW 1 166238566 missense probably damaging 0.99
R3710:Mael UTSW 1 166238566 missense probably damaging 0.99
R3880:Mael UTSW 1 166236868 splice site probably benign
R4594:Mael UTSW 1 166235487 missense probably damaging 1.00
R4669:Mael UTSW 1 166235508 missense probably damaging 1.00
R7382:Mael UTSW 1 166201598 missense probably benign 0.00
R8024:Mael UTSW 1 166226627 missense probably damaging 0.99
X0018:Mael UTSW 1 166201568 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTTTGTAGCCTCCAAAATTTAGG -3'
(R):5'- ACAAATGTTTCCATGTGCATTACCC -3'

Sequencing Primer
(F):5'- CCTCCAAAATTTAGGAATTTAAAGGC -3'
(R):5'- GTGCATTACCCACTCTTCTGTAATC -3'
Posted On2014-12-29