Incidental Mutation 'R2914:Rab22a'
ID254788
Institutional Source Beutler Lab
Gene Symbol Rab22a
Ensembl Gene ENSMUSG00000027519
Gene NameRAB22A, member RAS oncogene family
SynonymsRab22, E130120E14Rik, 3732413A17Rik
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173659760-173707343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173695281 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 98 (N98S)
Ref Sequence ENSEMBL: ENSMUSP00000029024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029024] [ENSMUST00000109110] [ENSMUST00000142820]
PDB Structure
GppNHp-Bound Rab22 GTPase [X-RAY DIFFRACTION]
Structure of GTP-Bound Rab22Q64L GTPase in complex with the minimal Rab binding domain of Rabenosyn-5 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000029024
AA Change: N98S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029024
Gene: ENSMUSG00000027519
AA Change: N98S

DomainStartEndE-ValueType
RAB 6 169 1.96e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109110
AA Change: N91S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104738
Gene: ENSMUSG00000027519
AA Change: N91S

DomainStartEndE-ValueType
Pfam:Arf 1 159 2.7e-8 PFAM
Pfam:Miro 7 114 4.3e-14 PFAM
Pfam:Ras 7 161 2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142820
SMART Domains Protein: ENSMUSP00000122799
Gene: ENSMUSG00000027519

DomainStartEndE-ValueType
Pfam:Ras 7 61 1.1e-11 PFAM
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Rab22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Rab22a APN 2 173688210 missense probably damaging 1.00
IGL01889:Rab22a APN 2 173688238 intron probably benign
IGL03113:Rab22a APN 2 173661472 missense probably damaging 1.00
PIT1430001:Rab22a UTSW 2 173695170 missense probably benign 0.09
R0304:Rab22a UTSW 2 173661459 missense probably damaging 1.00
R1937:Rab22a UTSW 2 173688211 missense probably damaging 1.00
R4473:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4474:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4476:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4559:Rab22a UTSW 2 173661433 missense probably damaging 1.00
R5163:Rab22a UTSW 2 173661487 missense probably damaging 0.99
R5934:Rab22a UTSW 2 173661504 missense probably damaging 1.00
R6753:Rab22a UTSW 2 173701055 missense probably benign
R7654:Rab22a UTSW 2 173688175 missense probably benign 0.00
R8089:Rab22a UTSW 2 173688220 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCAGTTTCGTGCATTGGC -3'
(R):5'- CTTGGAACTTCAGGGCCAAC -3'

Sequencing Primer
(F):5'- TTGGCACCAATGTACTATCGAGG -3'
(R):5'- GGGCCAACCATGTAACACAAG -3'
Posted On2014-12-29