Incidental Mutation 'R2914:Otud7b'
ID254790
Institutional Source Beutler Lab
Gene Symbol Otud7b
Ensembl Gene ENSMUSG00000038495
Gene NameOTU domain containing 7B
Synonyms4930463P07Rik, 2900060B22Rik, Za20d1
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96104527-96161129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96155955 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 837 (A837E)
Ref Sequence ENSEMBL: ENSMUSP00000096449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035519] [ENSMUST00000090785] [ENSMUST00000098849]
Predicted Effect probably benign
Transcript: ENSMUST00000035519
AA Change: A837E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000046413
Gene: ENSMUSG00000038495
AA Change: A837E

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.9e-30 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
low complexity region 821 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090785
AA Change: A837E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000088291
Gene: ENSMUSG00000038495
AA Change: A837E

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.9e-30 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
low complexity region 821 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098849
AA Change: A837E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000096449
Gene: ENSMUSG00000038495
AA Change: A837E

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.7e-27 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
Pfam:zf-A20 797 821 6.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135263
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, tertiary lymphoid hyperplasia, increased stimulated B cell proliferation and survival and decreased susceptibility to C. rodentium infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Otud7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Otud7b APN 3 96150980 splice site probably benign
IGL01651:Otud7b APN 3 96153490 nonsense probably null
IGL01941:Otud7b APN 3 96155459 missense probably benign 0.00
IGL02376:Otud7b APN 3 96155037 missense possibly damaging 0.48
IGL03047:Otud7b APN 3 96150984 splice site probably benign
IGL03189:Otud7b APN 3 96155478 missense probably benign
PIT4434001:Otud7b UTSW 3 96140465 missense probably damaging 1.00
R0605:Otud7b UTSW 3 96144959 unclassified probably benign
R1364:Otud7b UTSW 3 96151451 missense probably damaging 1.00
R1570:Otud7b UTSW 3 96155891 missense probably damaging 1.00
R2172:Otud7b UTSW 3 96153520 splice site probably null
R2199:Otud7b UTSW 3 96155772 missense probably damaging 1.00
R2842:Otud7b UTSW 3 96136594 missense probably damaging 1.00
R4716:Otud7b UTSW 3 96150910 missense probably damaging 0.96
R4810:Otud7b UTSW 3 96136607 missense probably damaging 1.00
R4878:Otud7b UTSW 3 96136510 utr 5 prime probably benign
R5327:Otud7b UTSW 3 96155738 missense probably benign
R5376:Otud7b UTSW 3 96153524 splice site probably null
R5530:Otud7b UTSW 3 96141488 missense probably damaging 1.00
R5741:Otud7b UTSW 3 96144304 missense probably damaging 1.00
R5877:Otud7b UTSW 3 96151960 nonsense probably null
R6365:Otud7b UTSW 3 96155250 missense probably benign 0.03
R7095:Otud7b UTSW 3 96155237 missense probably benign 0.01
R7404:Otud7b UTSW 3 96136625 critical splice donor site probably null
R7699:Otud7b UTSW 3 96155963 missense probably damaging 0.98
R7793:Otud7b UTSW 3 96155211 missense probably benign 0.01
R7840:Otud7b UTSW 3 96155373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGATTCCTATAGCAATGG -3'
(R):5'- CAAGTCAACTGTGTGCGCAG -3'

Sequencing Primer
(F):5'- GCAATGGCTACAGAGAGCCC -3'
(R):5'- TGCGCAGGAGCAGTACTG -3'
Posted On2014-12-29