Incidental Mutation 'R2914:Dclre1b'
ID254791
Institutional Source Beutler Lab
Gene Symbol Dclre1b
Ensembl Gene ENSMUSG00000027845
Gene NameDNA cross-link repair 1B
SynonymsSNMIB, Apollo, mSNM1B
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103800605-103809444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103808114 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 105 (M105V)
Ref Sequence ENSEMBL: ENSMUSP00000029435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029435] [ENSMUST00000047285] [ENSMUST00000063502] [ENSMUST00000076599] [ENSMUST00000106823] [ENSMUST00000106824] [ENSMUST00000106832] [ENSMUST00000106834] [ENSMUST00000128716] [ENSMUST00000198752] [ENSMUST00000199710] [ENSMUST00000200377]
Predicted Effect probably damaging
Transcript: ENSMUST00000029435
AA Change: M105V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029435
Gene: ENSMUSG00000027845
AA Change: M105V

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 301 1e-13 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000047285
SMART Domains Protein: ENSMUSP00000044262
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 7e-94 PFAM
Pfam:Cnd1 98 269 2.4e-11 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063502
SMART Domains Protein: ENSMUSP00000067695
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 49 4e-24 BLAST
Pfam:DRMBL 89 176 7.4e-20 PFAM
PDB:3BUA|H 366 400 8e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000076599
SMART Domains Protein: ENSMUSP00000075904
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 1e-93 PFAM
Pfam:Cnd1 98 286 3.9e-10 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106823
SMART Domains Protein: ENSMUSP00000102436
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 374 2e-68 PFAM
Pfam:Cnd1 98 285 1.4e-10 PFAM
Pfam:Adaptin_N 371 497 5.2e-16 PFAM
B2-adapt-app_C 591 703 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106824
SMART Domains Protein: ENSMUSP00000102437
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106832
AA Change: M105V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102445
Gene: ENSMUSG00000027845
AA Change: M105V

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106834
AA Change: M105V

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845
AA Change: M105V

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128716
SMART Domains Protein: ENSMUSP00000121063
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 63 3e-40 BLAST
PDB:3ZDK|A 1 63 3e-34 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147894
Predicted Effect probably damaging
Transcript: ENSMUST00000198752
AA Change: M23V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143067
Gene: ENSMUSG00000027845
AA Change: M23V

DomainStartEndE-ValueType
Blast:Lactamase_B 1 93 2e-64 BLAST
PDB:3ZDK|A 1 97 1e-62 PDB
SCOP:d1a7ta_ 3 93 5e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199723
Predicted Effect probably benign
Transcript: ENSMUST00000199710
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200377
SMART Domains Protein: ENSMUSP00000143355
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 7 357 2.9e-45 PFAM
B2-adapt-app_C 451 563 2.8e-46 SMART
Meta Mutation Damage Score 0.4906 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA interstrand cross-links prevent strand separation, thereby physically blocking transcription, replication, and segregation of DNA. DCLRE1B is one of several evolutionarily conserved genes involved in repair of interstrand cross-links (Dronkert et al., 2000 [PubMed 10848582]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryo size and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Dclre1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Dclre1b APN 3 103803126 missense probably benign
IGL01411:Dclre1b APN 3 103803323 missense probably damaging 1.00
IGL02311:Dclre1b APN 3 103808093 missense probably damaging 1.00
IGL03250:Dclre1b APN 3 103804064 splice site probably null
IGL03410:Dclre1b APN 3 103808140 missense probably damaging 1.00
IGL03046:Dclre1b UTSW 3 103803281 missense probably benign 0.00
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R1173:Dclre1b UTSW 3 103803876 missense probably benign 0.00
R1997:Dclre1b UTSW 3 103803356 missense probably benign 0.02
R2051:Dclre1b UTSW 3 103809040 missense possibly damaging 0.68
R3420:Dclre1b UTSW 3 103808096 missense probably damaging 1.00
R4247:Dclre1b UTSW 3 103804084 splice site probably null
R4250:Dclre1b UTSW 3 103804084 splice site probably null
R4474:Dclre1b UTSW 3 103807243 unclassified probably benign
R4866:Dclre1b UTSW 3 103808096 missense probably damaging 0.99
R5098:Dclre1b UTSW 3 103809136 unclassified probably benign
R5375:Dclre1b UTSW 3 103803974 missense probably damaging 1.00
R5796:Dclre1b UTSW 3 103807457 nonsense probably null
R5888:Dclre1b UTSW 3 103803737 missense probably damaging 1.00
R6189:Dclre1b UTSW 3 103803533 missense probably damaging 1.00
R6356:Dclre1b UTSW 3 103808155 missense probably damaging 1.00
R6443:Dclre1b UTSW 3 103803188 missense possibly damaging 0.82
R7471:Dclre1b UTSW 3 103803114 missense probably benign 0.00
R7994:Dclre1b UTSW 3 103803386 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAAATGTCTCTTTCCCACTCTTGG -3'
(R):5'- TCAGAACTCGGTCAGCTTTCC -3'

Sequencing Primer
(F):5'- CTGGGTGTCCTAGAACTCACTAAG -3'
(R):5'- GAACTCGGTCAGCTTTCCTTGATG -3'
Posted On2014-12-29