Incidental Mutation 'R2914:Tmod1'
ID254792
Institutional Source Beutler Lab
Gene Symbol Tmod1
Ensembl Gene ENSMUSG00000028328
Gene Nametropomodulin 1
Synonymserythrocyte tropomodulin, E-Tmod
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46038935-46116032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46092259 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 203 (N203I)
Ref Sequence ENSEMBL: ENSMUSP00000103402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107773] [ENSMUST00000156200]
Predicted Effect probably damaging
Transcript: ENSMUST00000107773
AA Change: N203I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103402
Gene: ENSMUSG00000028328
AA Change: N203I

DomainStartEndE-ValueType
Pfam:Tropomodulin 3 143 6.3e-64 PFAM
PDB:1IO0|A 160 344 1e-115 PDB
SCOP:d1a4ya_ 181 312 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136553
Predicted Effect probably benign
Transcript: ENSMUST00000156200
Meta Mutation Damage Score 0.9582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tropomodulin family. The encoded protein is an actin-capping protein that regulates tropomyosin by binding to its N-terminus, inhibiting depolymerization and elongation of the pointed end of actin filaments and thereby influencing the structure of the erythrocyte membrane skeleton. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this locus results in aborted heart development and consequent embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Tmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03375:Tmod1 APN 4 46096999 missense probably damaging 1.00
R1445:Tmod1 UTSW 4 46090884 missense probably damaging 1.00
R1513:Tmod1 UTSW 4 46083549 missense possibly damaging 0.61
R1888:Tmod1 UTSW 4 46097069 synonymous silent
R1980:Tmod1 UTSW 4 46061043 missense probably damaging 1.00
R3725:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R3726:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R3952:Tmod1 UTSW 4 46078315 missense probably damaging 0.98
R4854:Tmod1 UTSW 4 46090920 missense possibly damaging 0.80
R4989:Tmod1 UTSW 4 46090872 missense probably damaging 0.97
R6254:Tmod1 UTSW 4 46078469 splice site probably null
R7212:Tmod1 UTSW 4 46093951 nonsense probably null
R7570:Tmod1 UTSW 4 46083632 missense probably benign 0.15
R7572:Tmod1 UTSW 4 46083593 missense possibly damaging 0.53
Z1176:Tmod1 UTSW 4 46092271 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGGGAGTCCTTTTGTTG -3'
(R):5'- TGAGAGATTTGCCTGTTGACAC -3'

Sequencing Primer
(F):5'- CCTTTTGTTGGGAGAAAGTGACTC -3'
(R):5'- AGAGATTTGCCTGTTGACACTAGTC -3'
Posted On2014-12-29