Incidental Mutation 'R2914:Musk'
ID254793
Institutional Source Beutler Lab
Gene Symbol Musk
Ensembl Gene ENSMUSG00000057280
Gene Namemuscle, skeletal, receptor tyrosine kinase
SynonymsMDK4, Nsk1, Nsk2, Nsk3
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58285960-58374303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58366938 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 511 (L511I)
Ref Sequence ENSEMBL: ENSMUSP00000095667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081919] [ENSMUST00000084578] [ENSMUST00000098057] [ENSMUST00000098059] [ENSMUST00000102893] [ENSMUST00000177951] [ENSMUST00000179951]
Predicted Effect probably benign
Transcript: ENSMUST00000081919
AA Change: L509I

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080590
Gene: ENSMUSG00000057280
AA Change: L509I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084578
AA Change: L509I

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081625
Gene: ENSMUSG00000057280
AA Change: L509I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.2e-28 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098057
AA Change: L534I

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095665
Gene: ENSMUSG00000057280
AA Change: L534I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 342 467 1.4e-15 PFAM
transmembrane domain 520 542 N/A INTRINSIC
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 592 N/A INTRINSIC
TyrKc 599 880 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098059
AA Change: L511I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095667
Gene: ENSMUSG00000057280
AA Change: L511I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 2.1e-28 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102893
AA Change: L501I

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099957
Gene: ENSMUSG00000057280
AA Change: L501I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 487 509 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
TyrKc 566 847 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177951
AA Change: L511I

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136696
Gene: ENSMUSG00000057280
AA Change: L511I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 327 458 1.1e-27 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179951
AA Change: L519I

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137453
Gene: ENSMUSG00000057280
AA Change: L519I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 1.2e-27 PFAM
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
TyrKc 584 865 2.96e-140 SMART
Meta Mutation Damage Score 0.1587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack neuromuscular synapses and spontaneous movement, and die at birth of respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Musk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Musk APN 4 58367539 missense probably damaging 1.00
IGL01727:Musk APN 4 58303887 missense probably benign 0.37
IGL01981:Musk APN 4 58296629 missense probably damaging 1.00
IGL02064:Musk APN 4 58286128 missense possibly damaging 0.89
IGL02326:Musk APN 4 58354113 missense probably benign 0.02
IGL02475:Musk APN 4 58353936 critical splice acceptor site probably benign
IGL02585:Musk APN 4 58347849 missense probably benign
IGL02719:Musk APN 4 58356496 missense probably benign
IGL02797:Musk APN 4 58366921 missense probably benign 0.00
IGL02869:Musk APN 4 58354078 missense probably benign 0.05
IGL02940:Musk APN 4 58373364 missense probably damaging 1.00
IGL03167:Musk APN 4 58366821 missense possibly damaging 0.81
IGL03230:Musk APN 4 58296710 missense probably damaging 1.00
BB002:Musk UTSW 4 58367513 missense probably damaging 1.00
BB012:Musk UTSW 4 58367513 missense probably damaging 1.00
R0384:Musk UTSW 4 58373711 makesense probably null
R1014:Musk UTSW 4 58354156 missense possibly damaging 0.88
R1462:Musk UTSW 4 58286204 splice site probably benign
R1493:Musk UTSW 4 58354003 missense probably benign 0.19
R1739:Musk UTSW 4 58293563 missense probably damaging 1.00
R1883:Musk UTSW 4 58373189 missense probably benign 0.18
R2230:Musk UTSW 4 58333672 missense possibly damaging 0.79
R3508:Musk UTSW 4 58327347 missense probably damaging 0.98
R4225:Musk UTSW 4 58373240 missense probably damaging 0.99
R4601:Musk UTSW 4 58301625 missense probably damaging 0.99
R4771:Musk UTSW 4 58301706 missense probably benign 0.16
R4793:Musk UTSW 4 58373400 missense probably damaging 1.00
R4845:Musk UTSW 4 58296679 missense probably damaging 1.00
R4919:Musk UTSW 4 58366899 missense probably damaging 1.00
R4954:Musk UTSW 4 58344222 missense probably damaging 0.96
R5596:Musk UTSW 4 58373036 missense probably damaging 1.00
R5715:Musk UTSW 4 58333663 missense probably damaging 1.00
R5894:Musk UTSW 4 58373583 missense probably damaging 1.00
R5934:Musk UTSW 4 58373613 missense probably damaging 1.00
R6230:Musk UTSW 4 58367576 missense probably damaging 1.00
R6335:Musk UTSW 4 58366811 missense probably benign
R6358:Musk UTSW 4 58373171 missense possibly damaging 0.72
R6395:Musk UTSW 4 58286169 missense probably benign
R6652:Musk UTSW 4 58368977 missense probably damaging 1.00
R6764:Musk UTSW 4 58354027 missense probably damaging 1.00
R7233:Musk UTSW 4 58373307 missense possibly damaging 0.83
R7238:Musk UTSW 4 58344312 missense probably benign 0.01
R7271:Musk UTSW 4 58373409 missense probably damaging 1.00
R7511:Musk UTSW 4 58333672 missense probably benign 0.10
R7925:Musk UTSW 4 58367513 missense probably damaging 1.00
R8085:Musk UTSW 4 58373110 missense probably benign 0.00
R8243:Musk UTSW 4 58293600 missense probably benign
R8249:Musk UTSW 4 58368926 missense probably damaging 1.00
R8501:Musk UTSW 4 58367502 missense probably damaging 1.00
X0020:Musk UTSW 4 58368996 missense probably damaging 1.00
X0066:Musk UTSW 4 58327356 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATTCTTAAGGCCGTGGTAGC -3'
(R):5'- GGGTGTCTACTTGTAAAGCCATG -3'

Sequencing Primer
(F):5'- TCCAATGGTTCTGAAGTAAGCACG -3'
(R):5'- TGGTACAGACATCAGCGAGAC -3'
Posted On2014-12-29