Incidental Mutation 'R2914:Mutyh'
ID254795
Institutional Source Beutler Lab
Gene Symbol Mutyh
Ensembl Gene ENSMUSG00000028687
Gene NamemutY DNA glycosylase
SynonymsMutyha, 5730495A01Rik, Mutyhb, Mutyhc, Myh, Mutyhalpha, Mutyhbeta
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116807723-116819440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116815629 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 60 (D60N)
Ref Sequence ENSEMBL: ENSMUSP00000122777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055436] [ENSMUST00000102699] [ENSMUST00000130359] [ENSMUST00000155346]
Predicted Effect probably benign
Transcript: ENSMUST00000055436
SMART Domains Protein: ENSMUSP00000062327
Gene: ENSMUSG00000043155

DomainStartEndE-ValueType
SCOP:d1cjxa2 3 144 6e-7 SMART
PDB:1T47|B 4 367 8e-32 PDB
SCOP:d1cjxa2 161 367 5e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102699
AA Change: D60N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687
AA Change: D60N

DomainStartEndE-ValueType
ENDO3c 107 259 1.46e-52 SMART
FES 260 280 2.16e-5 SMART
Pfam:NUDIX_4 353 463 2.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124857
Predicted Effect probably damaging
Transcript: ENSMUST00000130359
AA Change: D60N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140680
Predicted Effect probably damaging
Transcript: ENSMUST00000155346
AA Change: D60N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122777
Gene: ENSMUSG00000028687
AA Change: D60N

DomainStartEndE-ValueType
PDB:3N5N|Y 50 100 3e-20 PDB
SCOP:d1keaa_ 59 86 3e-3 SMART
Meta Mutation Damage Score 0.1435 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. Mutations in this gene result in heritable predisposition to colon and stomach cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and show no increase in tumor incidence relative to wild-type through 17 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Mutyh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mutyh APN 4 116819319 missense possibly damaging 0.78
IGL02212:Mutyh APN 4 116815606 missense probably damaging 1.00
BB007:Mutyh UTSW 4 116816956 missense probably benign 0.35
BB017:Mutyh UTSW 4 116816956 missense probably benign 0.35
PIT4362001:Mutyh UTSW 4 116817070 missense probably damaging 1.00
R1520:Mutyh UTSW 4 116817552 missense probably damaging 1.00
R1928:Mutyh UTSW 4 116816658 missense probably damaging 1.00
R1987:Mutyh UTSW 4 116819368 missense possibly damaging 0.47
R3694:Mutyh UTSW 4 116816454 missense possibly damaging 0.62
R4722:Mutyh UTSW 4 116816872 missense probably damaging 1.00
R4801:Mutyh UTSW 4 116817029 missense probably benign 0.17
R4802:Mutyh UTSW 4 116817029 missense probably benign 0.17
R4837:Mutyh UTSW 4 116817690 missense probably damaging 1.00
R4993:Mutyh UTSW 4 116817935 missense probably benign 0.01
R7930:Mutyh UTSW 4 116816956 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTTCCAGAGATGACTCAGCTC -3'
(R):5'- TGTACTGACCAGCATAGGCC -3'

Sequencing Primer
(F):5'- GATGACTCAGCTCTCAGGCAGTTC -3'
(R):5'- AGCATAGGCCCTCCTGTC -3'
Posted On2014-12-29