Incidental Mutation 'R2914:Txk'
ID254799
Institutional Source Beutler Lab
Gene Symbol Txk
Ensembl Gene ENSMUSG00000054892
Gene NameTXK tyrosine kinase
SynonymsA130089B16Rik, PTK4, Btkl, Rlk
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72695978-72752777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72724451 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 154 (N154S)
Ref Sequence ENSEMBL: ENSMUSP00000129397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113604] [ENSMUST00000169534] [ENSMUST00000197313] [ENSMUST00000198464]
Predicted Effect probably damaging
Transcript: ENSMUST00000113604
AA Change: N154S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109234
Gene: ENSMUSG00000054892
AA Change: N154S

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169534
AA Change: N154S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129397
Gene: ENSMUSG00000054892
AA Change: N154S

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 141 9.99e-17 SMART
SH2 148 237 8.27e-34 SMART
TyrKc 271 520 2.52e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197313
AA Change: N132S

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143476
Gene: ENSMUSG00000054892
AA Change: N132S

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
SH3 85 138 1.2e-9 SMART
SH2 126 215 3.1e-35 SMART
TyrKc 249 498 1.2e-136 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197843
Predicted Effect possibly damaging
Transcript: ENSMUST00000198464
AA Change: N100S

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143002
Gene: ENSMUSG00000054892
AA Change: N100S

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
SH3 31 87 6.3e-19 SMART
SH2 94 183 5.4e-36 SMART
TyrKc 217 466 1.2e-136 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198970
Meta Mutation Damage Score 0.1066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased susceptibility to parasitic (Toxoplasma gondii) infection and decreased cytokine secretion in stimulated splenocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Txk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Txk APN 5 72707546 missense possibly damaging 0.94
IGL02602:Txk APN 5 72707720 missense possibly damaging 0.89
IGL03353:Txk APN 5 72736402 missense probably benign
BB007:Txk UTSW 5 72735193 missense probably damaging 1.00
BB017:Txk UTSW 5 72735193 missense probably damaging 1.00
R0402:Txk UTSW 5 72731762 critical splice donor site probably null
R1509:Txk UTSW 5 72699110 missense probably damaging 1.00
R1511:Txk UTSW 5 72707671 missense probably damaging 1.00
R1785:Txk UTSW 5 72696579 missense probably damaging 1.00
R1786:Txk UTSW 5 72696579 missense probably damaging 1.00
R2131:Txk UTSW 5 72696579 missense probably damaging 1.00
R2913:Txk UTSW 5 72724451 missense probably damaging 1.00
R3722:Txk UTSW 5 72707735 nonsense probably null
R4080:Txk UTSW 5 72700663 missense probably damaging 1.00
R5341:Txk UTSW 5 72696621 missense probably benign 0.08
R5580:Txk UTSW 5 72707589 missense probably damaging 1.00
R6155:Txk UTSW 5 72700726 missense probably damaging 1.00
R6310:Txk UTSW 5 72736417 missense probably benign 0.01
R6382:Txk UTSW 5 72736480 intron probably benign
R6938:Txk UTSW 5 72699149 missense probably damaging 0.99
R7225:Txk UTSW 5 72700714 missense probably damaging 1.00
R7327:Txk UTSW 5 72715883 missense probably damaging 0.98
R7337:Txk UTSW 5 72731766 nonsense probably null
R7436:Txk UTSW 5 72696579 missense probably damaging 1.00
R7510:Txk UTSW 5 72736383 missense unknown
R7709:Txk UTSW 5 72707575 missense probably damaging 1.00
R7725:Txk UTSW 5 72707557 missense probably damaging 0.96
R7930:Txk UTSW 5 72735193 missense probably damaging 1.00
R8124:Txk UTSW 5 72703263 splice site probably null
Z1176:Txk UTSW 5 72735211 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTGAAATGATGAAGGCAGTCAG -3'
(R):5'- TACTTCATGGGCCAGAAGAGG -3'

Sequencing Primer
(F):5'- GGTGATCTTATGAAGACACATCAG -3'
(R):5'- GGGATGTGAGCTATGGTAGAATAATC -3'
Posted On2014-12-29