Incidental Mutation 'R2914:Lrrtm1'
ID254802
Institutional Source Beutler Lab
Gene Symbol Lrrtm1
Ensembl Gene ENSMUSG00000060780
Gene Nameleucine rich repeat transmembrane neuronal 1
Synonyms4632401D06Rik
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location77242689-77257791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77244979 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 473 (Q473L)
Ref Sequence ENSEMBL: ENSMUSP00000124373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020400] [ENSMUST00000075340] [ENSMUST00000159616] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161677] [ENSMUST00000161811] [ENSMUST00000161846]
Predicted Effect probably damaging
Transcript: ENSMUST00000020400
AA Change: Q473L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020400
Gene: ENSMUSG00000060780
AA Change: Q473L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075340
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159616
AA Change: Q473L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125207
Gene: ENSMUSG00000060780
AA Change: Q473L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159626
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160894
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161677
AA Change: Q473L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124373
Gene: ENSMUSG00000060780
AA Change: Q473L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161811
SMART Domains Protein: ENSMUSP00000124948
Gene: ENSMUSG00000060780

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161846
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Meta Mutation Damage Score 0.0887 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with grossly normal brain morphology. Mice homozygous for another knock-out allele exhibit impaired cognitive function and altered hippocampal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Lrrtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Lrrtm1 APN 6 77244063 missense probably benign 0.00
IGL01011:Lrrtm1 APN 6 77244235 splice site probably null
IGL01125:Lrrtm1 APN 6 77244453 missense probably damaging 1.00
IGL01924:Lrrtm1 APN 6 77244186 missense possibly damaging 0.81
IGL02508:Lrrtm1 APN 6 77244591 missense probably damaging 1.00
IGL03005:Lrrtm1 APN 6 77244156 missense probably damaging 1.00
IGL03076:Lrrtm1 APN 6 77244585 missense probably damaging 1.00
R0077:Lrrtm1 UTSW 6 77243872 missense probably damaging 1.00
R0540:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0607:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0927:Lrrtm1 UTSW 6 77244860 missense probably damaging 1.00
R1742:Lrrtm1 UTSW 6 77244091 missense probably damaging 1.00
R1762:Lrrtm1 UTSW 6 77244697 missense probably benign
R1933:Lrrtm1 UTSW 6 77244966 splice site probably null
R1934:Lrrtm1 UTSW 6 77244966 splice site probably null
R2180:Lrrtm1 UTSW 6 77244346 missense probably damaging 1.00
R2267:Lrrtm1 UTSW 6 77244013 missense probably damaging 0.97
R2937:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R2938:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R4604:Lrrtm1 UTSW 6 77244144 missense probably damaging 1.00
R4908:Lrrtm1 UTSW 6 77244678 missense probably benign 0.01
R4910:Lrrtm1 UTSW 6 77244901 missense probably damaging 1.00
R5739:Lrrtm1 UTSW 6 77244889 missense probably damaging 0.99
R6604:Lrrtm1 UTSW 6 77244238 missense possibly damaging 0.70
R6845:Lrrtm1 UTSW 6 77243881 missense probably benign 0.02
R7048:Lrrtm1 UTSW 6 77244169 missense probably damaging 1.00
R7203:Lrrtm1 UTSW 6 77243601 missense probably damaging 1.00
R7783:Lrrtm1 UTSW 6 77244253 missense probably damaging 1.00
R7826:Lrrtm1 UTSW 6 77244112 splice site probably null
R8164:Lrrtm1 UTSW 6 77244216 missense probably damaging 1.00
R8303:Lrrtm1 UTSW 6 77244679 missense probably benign 0.03
RF018:Lrrtm1 UTSW 6 77244351 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTTGAGCCCATCACTGTGG -3'
(R):5'- GTCAACAAATCAGAGCGCAG -3'

Sequencing Primer
(F):5'- AGCCCATCACTGTGGCTCTTC -3'
(R):5'- CCCAGGCGTATTTGGTAGC -3'
Posted On2014-12-29