Incidental Mutation 'R2914:Vmn1r65'
ID254803
Institutional Source Beutler Lab
Gene Symbol Vmn1r65
Ensembl Gene ENSMUSG00000066850
Gene Namevomeronasal 1 receptor 65
SynonymsV3R6, V1rd6
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6007750-6011010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6009041 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 65 (I65F)
Ref Sequence ENSEMBL: ENSMUSP00000083520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086338]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086338
AA Change: I65F

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083520
Gene: ENSMUSG00000066850
AA Change: I65F

DomainStartEndE-ValueType
Pfam:TAS2R 20 308 7.3e-14 PFAM
Pfam:7tm_1 42 301 1.6e-6 PFAM
Pfam:V1R 53 308 5.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227656
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Vmn1r65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Vmn1r65 APN 7 6008721 missense probably benign 0.12
IGL02821:Vmn1r65 APN 7 6008894 missense possibly damaging 0.62
R0991:Vmn1r65 UTSW 7 6009077 missense probably damaging 0.99
R1457:Vmn1r65 UTSW 7 6009157 missense probably benign 0.10
R1507:Vmn1r65 UTSW 7 6009109 missense probably benign 0.13
R1856:Vmn1r65 UTSW 7 6008266 missense possibly damaging 0.93
R5147:Vmn1r65 UTSW 7 6008819 missense probably benign 0.01
R5279:Vmn1r65 UTSW 7 6008755 missense probably damaging 1.00
R5399:Vmn1r65 UTSW 7 6008810 nonsense probably null
R5409:Vmn1r65 UTSW 7 6009013 missense possibly damaging 0.77
R5646:Vmn1r65 UTSW 7 6009224 missense probably benign 0.01
R5963:Vmn1r65 UTSW 7 6008609 missense probably damaging 1.00
R6034:Vmn1r65 UTSW 7 6008869 missense probably damaging 1.00
R6034:Vmn1r65 UTSW 7 6008869 missense probably damaging 1.00
R6327:Vmn1r65 UTSW 7 6008652 missense possibly damaging 0.48
R7958:Vmn1r65 UTSW 7 6008255 missense probably benign 0.01
R8121:Vmn1r65 UTSW 7 6008465 missense possibly damaging 0.87
R8345:Vmn1r65 UTSW 7 6008257 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAAGATGACCCTAGCCCAG -3'
(R):5'- TGAAGCCATCTCCACGTTGTC -3'

Sequencing Primer
(F):5'- TGACAAACTGGTAGGTGCTG -3'
(R):5'- GAATTCTGGGCAACATCC -3'
Posted On2014-12-29