Incidental Mutation 'R2914:Defb12'
ID254804
Institutional Source Beutler Lab
Gene Symbol Defb12
Ensembl Gene ENSMUSG00000043787
Gene Namedefensin beta 12
SynonymsmBD-12, 9230103N16Rik
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location19111931-19114839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19114814 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 3 (N3D)
Ref Sequence ENSEMBL: ENSMUSP00000060899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062113]
Predicted Effect probably benign
Transcript: ENSMUST00000062113
AA Change: N3D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060899
Gene: ENSMUSG00000043787
AA Change: N3D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Defensin_beta_2 52 81 2.7e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Defb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0269:Defb12 UTSW 8 19114359 missense probably damaging 0.99
R1843:Defb12 UTSW 8 19112738 missense probably damaging 1.00
R4303:Defb12 UTSW 8 19112721 missense probably benign
R5377:Defb12 UTSW 8 19114326 critical splice donor site probably null
R5618:Defb12 UTSW 8 19114798 missense possibly damaging 0.86
R6741:Defb12 UTSW 8 19114741 missense probably benign 0.04
R8088:Defb12 UTSW 8 19112821 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGAGATCCAAGAAATCTCTGG -3'
(R):5'- AGAAGTAAGGCTTTGCAGGC -3'

Sequencing Primer
(F):5'- CTCTGGGGAGAGGAGAGTTACTC -3'
(R):5'- AGGCTCAAGGTTATTACCCACTG -3'
Posted On2014-12-29