Incidental Mutation 'R2914:Il27ra'
ID254806
Institutional Source Beutler Lab
Gene Symbol Il27ra
Ensembl Gene ENSMUSG00000005465
Gene Nameinterleukin 27 receptor, alpha
SynonymsIL-27R, WSX-1, Tccr
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84030294-84042589 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 84031613 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000055077]
Predicted Effect probably benign
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055077
SMART Domains Protein: ENSMUSP00000051396
Gene: ENSMUSG00000047986

DomainStartEndE-ValueType
coiled coil region 19 64 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
coiled coil region 90 116 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
low complexity region 399 416 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mice, CD4+ helper T-cells differentiate into type 1 (Th1) cells, which are critical for cell-mediated immunity, predominantly under the influence of IL12. Also, IL4 influences their differentiation into type 2 (Th2) cells, which are critical for most antibody responses. Mice deficient in these cytokines, their receptors, or associated transcription factors have impaired, but are not absent of, Th1 or Th2 immune responses. This gene encodes a protein which is similar to the mouse T-cell cytokine receptor Tccr at the amino acid level, and is predicted to be a glycosylated transmembrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: T helper 1 response and responses to parasitic and bacterial infection are altered in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Il27ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:Il27ra APN 8 84031535 missense probably benign 0.01
IGL03096:Il27ra APN 8 84031532 missense probably damaging 1.00
IGL03334:Il27ra APN 8 84031122 missense probably benign 0.08
angel UTSW 8 84032144 critical splice acceptor site probably null
Gabriel UTSW 8 84033985 missense probably damaging 0.97
herald UTSW 8 84033949 critical splice donor site probably null
R0133:Il27ra UTSW 8 84033942 unclassified probably benign
R0526:Il27ra UTSW 8 84039499 missense probably benign 0.37
R3001:Il27ra UTSW 8 84032031 nonsense probably null
R3002:Il27ra UTSW 8 84032031 nonsense probably null
R3003:Il27ra UTSW 8 84032031 nonsense probably null
R3851:Il27ra UTSW 8 84040688 missense probably benign 0.00
R3978:Il27ra UTSW 8 84040684 missense probably benign 0.11
R4589:Il27ra UTSW 8 84036409 missense probably damaging 1.00
R4997:Il27ra UTSW 8 84039527 nonsense probably null
R5133:Il27ra UTSW 8 84034059 missense possibly damaging 0.71
R5955:Il27ra UTSW 8 84040822 missense probably benign 0.05
R6153:Il27ra UTSW 8 84032144 critical splice acceptor site probably null
R6489:Il27ra UTSW 8 84031550 missense probably benign 0.02
R7465:Il27ra UTSW 8 84039612 missense probably benign 0.00
R7828:Il27ra UTSW 8 84031558 missense probably damaging 1.00
R7890:Il27ra UTSW 8 84033985 missense probably damaging 0.97
R8051:Il27ra UTSW 8 84033949 critical splice donor site probably null
R8137:Il27ra UTSW 8 84041091 critical splice acceptor site probably null
R8335:Il27ra UTSW 8 84039501 missense probably damaging 0.96
X0013:Il27ra UTSW 8 84042159 missense probably benign 0.21
Z1176:Il27ra UTSW 8 84040990 missense probably damaging 1.00
Z1177:Il27ra UTSW 8 84040975 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATCCATGAACTTTCTGAGCCC -3'
(R):5'- TGTCTAAAACAGCTGCACTCC -3'

Sequencing Primer
(F):5'- CATGAACTTTCTGAGCCCTGAGG -3'
(R):5'- GGCTTTGCCTGTCAGCACAC -3'
Posted On2014-12-29