Incidental Mutation 'R2914:Fa2h'
ID254807
Institutional Source Beutler Lab
Gene Symbol Fa2h
Ensembl Gene ENSMUSG00000033579
Gene Namefatty acid 2-hydroxylase
SynonymsFaxdc1, G630055L08Rik
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R2914 (G1)
Quality Score188
Status Validated
Chromosome8
Chromosomal Location111345135-111393824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111393649 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 35 (D35G)
Ref Sequence ENSEMBL: ENSMUSP00000043597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038475]
Predicted Effect probably damaging
Transcript: ENSMUST00000038475
AA Change: D35G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043597
Gene: ENSMUSG00000033579
AA Change: D35G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Cyt-b5 11 86 2.85e-15 SMART
low complexity region 115 126 N/A INTRINSIC
transmembrane domain 169 191 N/A INTRINSIC
Pfam:FA_hydroxylase 219 361 4.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162463
Meta Mutation Damage Score 0.9469 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele show demyelination, axonal loss, and cerebellar dysfunction. Homozygotes for a different null allele show late onset axon and myelin sheath degeneration, delayed fur emergence, altered sebum composition, sebocyte hyperproliferation, and cyclic alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Fa2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Fa2h APN 8 111349304 missense possibly damaging 0.55
IGL02983:Fa2h APN 8 111346522 critical splice acceptor site probably null
IGL03350:Fa2h APN 8 111349296 missense probably benign 0.05
sparse UTSW 8 111355398 critical splice donor site probably null
R0016:Fa2h UTSW 8 111393514 missense probably damaging 1.00
R0363:Fa2h UTSW 8 111349289 missense probably damaging 1.00
R0576:Fa2h UTSW 8 111356147 missense probably damaging 1.00
R3803:Fa2h UTSW 8 111355398 critical splice donor site probably null
R3924:Fa2h UTSW 8 111393515 missense probably damaging 1.00
R5203:Fa2h UTSW 8 111349364 missense probably benign 0.00
R5253:Fa2h UTSW 8 111349237 missense probably benign 0.00
R6547:Fa2h UTSW 8 111348020 missense probably damaging 1.00
R7595:Fa2h UTSW 8 111355490 missense probably benign 0.01
R8050:Fa2h UTSW 8 111348185 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTCTAAAGTGGCGGACTG -3'
(R):5'- AGTCACCTTCAATGCGCTGG -3'

Sequencing Primer
(F):5'- GGTGTGAGGCAGGGAGC -3'
(R):5'- TCCCGAGATGTTAGAGGCG -3'
Posted On2014-12-29