Mutagenetix > Incidental Mutations

Incidental Mutation 'R2914:Snx19'

254808

Institutional Source

Beutler Lab

Gene Symbol

Snx19

Ensembl Gene

ENSMUSG00000031993

Gene Name

sorting nexin 19

Synonyms

3526401K03Rik

MMRRC Submission

040501-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R2914 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30427108-30466733 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 30433532 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164099] [ENSMUST00000216545]

Predicted Effect

probably benign
Transcript: ENSMUST00000164099

SMART Domains

Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993

Domain	Start	End	E-Value	Type
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	51	73	N/A	INTRINSIC
Pfam:PXA	96	269	2.9e-43	PFAM
low complexity region	324	335	N/A	INTRINSIC
low complexity region	371	385	N/A	INTRINSIC
low complexity region	504	528	N/A	INTRINSIC
PX	533	664	1.83e-24	SMART
Pfam:Nexin_C	843	951	1.9e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216545

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216552

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	A	G	5: 30,196,994	S679P	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cryl1	T	C	14: 57,275,918	E282G	probably benign	Het
Dbn1	A	G	13: 55,482,421	F45L	probably damaging	Het
Dclre1b	T	C	3: 103,808,114	M105V	probably damaging	Het
Defb12	T	C	8: 19,114,814	N3D	probably benign	Het
Eprs	G	A	1: 185,379,742		probably null	Het
Fa2h	T	C	8: 111,393,649	D35G	probably damaging	Het
Fdxacb1	C	T	9: 50,768,399	A39V	probably benign	Het
Fras1	G	A	5: 96,733,915	R2502K	probably benign	Het
Grm1	A	G	10: 11,079,857	S228P	probably benign	Het
Il27ra	T	A	8: 84,031,613		probably benign	Het
Lrrtm1	A	T	6: 77,244,979	Q473L	probably damaging	Het
Macf1	T	A	4: 123,475,911	I121F	probably damaging	Het
Mael	A	T	1: 166,226,610	F188I	probably damaging	Het
Mapk4	C	T	18: 73,935,165	A232T	probably benign	Het
Mrpl9	C	A	3: 94,443,801	T96K	probably damaging	Het
Musk	C	A	4: 58,366,938	L511I	probably damaging	Het
Mutyh	G	A	4: 116,815,629	D60N	probably damaging	Het
Nckap5	A	T	1: 126,026,537		probably null	Het
Nktr	T	C	9: 121,749,604		probably benign	Het
Otud7b	C	A	3: 96,155,955	A837E	probably benign	Het
Pigb	A	T	9: 73,039,778		probably null	Het
Pip4k2b	G	T	11: 97,722,434	N245K	probably benign	Het
Ptprd	T	A	4: 75,947,101	D1464V	probably damaging	Het
Rab22a	A	G	2: 173,695,281	N98S	probably benign	Het
Rictor	G	T	15: 6,769,995		probably null	Het
Rims1	T	C	1: 22,805,630	E32G	probably damaging	Het
Slx4ip	A	G	2: 137,067,591		probably null	Het
Snx29	C	T	16: 11,447,453	R516W	probably damaging	Het
Tcof1	T	C	18: 60,816,084	D1253G	possibly damaging	Het
Tmod1	A	T	4: 46,092,259	N203I	probably damaging	Het
Tmprss15	T	C	16: 78,962,190	N880S	probably benign	Het
Ttn	A	T	2: 76,769,635	I19065N	probably damaging	Het
Txk	T	C	5: 72,724,451	N154S	probably damaging	Het
Utp20	A	G	10: 88,754,475		probably null	Het
Vmn1r65	T	A	7: 6,009,041	I65F	possibly damaging	Het
Yes1	T	C	5: 32,640,582	S82P	probably benign	Het

Other mutations in Snx19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Snx19	APN	9	30429084	missense	possibly damaging	0.92
IGL00498:Snx19	APN	9	30428937	missense	possibly damaging	0.92
IGL00718:Snx19	APN	9	30432326	missense	probably damaging	1.00
IGL00902:Snx19	APN	9	30428732	missense	possibly damaging	0.90
IGL01433:Snx19	APN	9	30428771	missense	possibly damaging	0.93
IGL01668:Snx19	APN	9	30427823	missense	probably benign
IGL01732:Snx19	APN	9	30462353	missense	probably damaging	1.00
IGL01767:Snx19	APN	9	30463264	missense	possibly damaging	0.95
IGL02638:Snx19	APN	9	30432364	missense	possibly damaging	0.52
IGL02718:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02719:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02723:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02724:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02725:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02892:Snx19	APN	9	30428364	missense	probably damaging	1.00
IGL03061:Snx19	APN	9	30433632	missense	probably damaging	0.99
IGL03402:Snx19	APN	9	30440134	missense	possibly damaging	0.89
R0125:Snx19	UTSW	9	30440219	missense	probably damaging	1.00
R0133:Snx19	UTSW	9	30428616	missense	possibly damaging	0.94
R0196:Snx19	UTSW	9	30433387	missense	probably damaging	1.00
R0423:Snx19	UTSW	9	30435837	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428810	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428811	missense	probably damaging	1.00
R1068:Snx19	UTSW	9	30429018	missense	probably damaging	0.99
R1570:Snx19	UTSW	9	30428343	missense	probably damaging	1.00
R1727:Snx19	UTSW	9	30433366	missense	probably damaging	1.00
R1895:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1907:Snx19	UTSW	9	30433576	missense	probably damaging	0.99
R1946:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1989:Snx19	UTSW	9	30428108	missense	possibly damaging	0.93
R2029:Snx19	UTSW	9	30429000	missense	probably benign	0.01
R3880:Snx19	UTSW	9	30462392	missense	probably damaging	1.00
R4223:Snx19	UTSW	9	30428448	missense	possibly damaging	0.95
R4415:Snx19	UTSW	9	30437483	missense	probably damaging	0.99
R4438:Snx19	UTSW	9	30428599	missense	probably benign	0.01
R4484:Snx19	UTSW	9	30427896	missense	probably benign	0.01
R4585:Snx19	UTSW	9	30440195	missense	probably damaging	1.00
R4765:Snx19	UTSW	9	30440157	missense	probably damaging	1.00
R4771:Snx19	UTSW	9	30433638	missense	probably damaging	1.00
R4922:Snx19	UTSW	9	30437467	missense	probably benign	0.25
R5096:Snx19	UTSW	9	30428786	missense	probably benign	0.40
R5464:Snx19	UTSW	9	30427973	missense	possibly damaging	0.54
R6469:Snx19	UTSW	9	30427743	missense	possibly damaging	0.50
R6886:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R6988:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R7131:Snx19	UTSW	9	30427893	missense	probably damaging	1.00
R7268:Snx19	UTSW	9	30440177	missense	probably damaging	1.00
R7772:Snx19	UTSW	9	30428925	missense	probably damaging	0.99
X0019:Snx19	UTSW	9	30437366	missense	probably damaging	1.00
X0024:Snx19	UTSW	9	30427721	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCCATGAGATGTCTCTGTGTGC -3'
(R):5'- TAATGCACACCTCCCACTTG -3'

Sequencing Primer
(F):5'- CATGCTAAGTGGATGAATTTGCTC -3'
(R):5'- TCCCACTTGCAGAAGGGAC -3'

Posted On

2014-12-29