Incidental Mutation 'R2914:Snx19'
ID254808
Institutional Source Beutler Lab
Gene Symbol Snx19
Ensembl Gene ENSMUSG00000031993
Gene Namesorting nexin 19
Synonyms3526401K03Rik
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location30427108-30466733 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 30433532 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164099] [ENSMUST00000216545]
Predicted Effect probably benign
Transcript: ENSMUST00000164099
SMART Domains Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993

DomainStartEndE-ValueType
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:PXA 96 269 2.9e-43 PFAM
low complexity region 324 335 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 504 528 N/A INTRINSIC
PX 533 664 1.83e-24 SMART
Pfam:Nexin_C 843 951 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216552
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Snx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Snx19 APN 9 30429084 missense possibly damaging 0.92
IGL00498:Snx19 APN 9 30428937 missense possibly damaging 0.92
IGL00718:Snx19 APN 9 30432326 missense probably damaging 1.00
IGL00902:Snx19 APN 9 30428732 missense possibly damaging 0.90
IGL01433:Snx19 APN 9 30428771 missense possibly damaging 0.93
IGL01668:Snx19 APN 9 30427823 missense probably benign
IGL01732:Snx19 APN 9 30462353 missense probably damaging 1.00
IGL01767:Snx19 APN 9 30463264 missense possibly damaging 0.95
IGL02638:Snx19 APN 9 30432364 missense possibly damaging 0.52
IGL02718:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02719:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02723:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02724:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02725:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02892:Snx19 APN 9 30428364 missense probably damaging 1.00
IGL03061:Snx19 APN 9 30433632 missense probably damaging 0.99
IGL03402:Snx19 APN 9 30440134 missense possibly damaging 0.89
R0125:Snx19 UTSW 9 30440219 missense probably damaging 1.00
R0133:Snx19 UTSW 9 30428616 missense possibly damaging 0.94
R0196:Snx19 UTSW 9 30433387 missense probably damaging 1.00
R0423:Snx19 UTSW 9 30435837 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428810 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428811 missense probably damaging 1.00
R1068:Snx19 UTSW 9 30429018 missense probably damaging 0.99
R1570:Snx19 UTSW 9 30428343 missense probably damaging 1.00
R1727:Snx19 UTSW 9 30433366 missense probably damaging 1.00
R1895:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1907:Snx19 UTSW 9 30433576 missense probably damaging 0.99
R1946:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1989:Snx19 UTSW 9 30428108 missense possibly damaging 0.93
R2029:Snx19 UTSW 9 30429000 missense probably benign 0.01
R3880:Snx19 UTSW 9 30462392 missense probably damaging 1.00
R4223:Snx19 UTSW 9 30428448 missense possibly damaging 0.95
R4415:Snx19 UTSW 9 30437483 missense probably damaging 0.99
R4438:Snx19 UTSW 9 30428599 missense probably benign 0.01
R4484:Snx19 UTSW 9 30427896 missense probably benign 0.01
R4585:Snx19 UTSW 9 30440195 missense probably damaging 1.00
R4765:Snx19 UTSW 9 30440157 missense probably damaging 1.00
R4771:Snx19 UTSW 9 30433638 missense probably damaging 1.00
R4922:Snx19 UTSW 9 30437467 missense probably benign 0.25
R5096:Snx19 UTSW 9 30428786 missense probably benign 0.40
R5464:Snx19 UTSW 9 30427973 missense possibly damaging 0.54
R6469:Snx19 UTSW 9 30427743 missense possibly damaging 0.50
R6886:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R6988:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R7131:Snx19 UTSW 9 30427893 missense probably damaging 1.00
R7268:Snx19 UTSW 9 30440177 missense probably damaging 1.00
R7772:Snx19 UTSW 9 30428925 missense probably damaging 0.99
X0019:Snx19 UTSW 9 30437366 missense probably damaging 1.00
X0024:Snx19 UTSW 9 30427721 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCATGAGATGTCTCTGTGTGC -3'
(R):5'- TAATGCACACCTCCCACTTG -3'

Sequencing Primer
(F):5'- CATGCTAAGTGGATGAATTTGCTC -3'
(R):5'- TCCCACTTGCAGAAGGGAC -3'
Posted On2014-12-29