Incidental Mutation 'R2914:Fdxacb1'
ID254809
Institutional Source Beutler Lab
Gene Symbol Fdxacb1
Ensembl Gene ENSMUSG00000037845
Gene Nameferredoxin-fold anticodon binding domain containing 1
Synonyms
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50768236-50773348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50768399 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 39 (A39V)
Ref Sequence ENSEMBL: ENSMUSP00000135796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042391] [ENSMUST00000042468] [ENSMUST00000042576] [ENSMUST00000176145] [ENSMUST00000176238] [ENSMUST00000176335] [ENSMUST00000177384] [ENSMUST00000177546]
Predicted Effect probably benign
Transcript: ENSMUST00000042391
AA Change: A39V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000037082
Gene: ENSMUSG00000037845
AA Change: A39V

DomainStartEndE-ValueType
Pfam:DUF2431 7 176 1.4e-44 PFAM
low complexity region 258 269 N/A INTRINSIC
SCOP:d1jjca_ 487 516 6e-4 SMART
FDX-ACB 528 622 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042468
SMART Domains Protein: ENSMUSP00000041803
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 149 7.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042576
SMART Domains Protein: ENSMUSP00000046890
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 15 164 1.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176145
AA Change: A39V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135796
Gene: ENSMUSG00000037845
AA Change: A39V

DomainStartEndE-ValueType
Pfam:DUF2431 7 115 4.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176160
Predicted Effect probably benign
Transcript: ENSMUST00000176238
SMART Domains Protein: ENSMUSP00000135679
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 70 4.2e-47 PFAM
Pfam:DUF1143 68 126 5.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176335
SMART Domains Protein: ENSMUSP00000135658
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1jjca_ 285 314 3e-4 SMART
FDX-ACB 326 420 5.88e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177142
Predicted Effect probably benign
Transcript: ENSMUST00000177384
Predicted Effect probably benign
Transcript: ENSMUST00000177546
SMART Domains Protein: ENSMUSP00000134870
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 13 72 3.3e-39 PFAM
Meta Mutation Damage Score 0.0949 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a ferredoxin-fold anticodon-binding domain which is contained in a subset of phenylalanyl tRNA synthetases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Fdxacb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Fdxacb1 APN 9 50771563 missense possibly damaging 0.75
IGL02828:Fdxacb1 APN 9 50771564 missense possibly damaging 0.75
IGL02799:Fdxacb1 UTSW 9 50772596 missense probably benign 0.01
R0755:Fdxacb1 UTSW 9 50771725 missense possibly damaging 0.87
R1283:Fdxacb1 UTSW 9 50768694 missense possibly damaging 0.79
R1395:Fdxacb1 UTSW 9 50772496 frame shift probably null
R1991:Fdxacb1 UTSW 9 50771646 missense probably benign 0.00
R2103:Fdxacb1 UTSW 9 50771646 missense probably benign 0.00
R2273:Fdxacb1 UTSW 9 50772021 missense probably benign 0.01
R2913:Fdxacb1 UTSW 9 50768399 missense probably benign 0.05
R4289:Fdxacb1 UTSW 9 50772579 missense probably damaging 0.99
R4492:Fdxacb1 UTSW 9 50770247 missense probably damaging 0.99
R4668:Fdxacb1 UTSW 9 50770260 missense possibly damaging 0.74
R4742:Fdxacb1 UTSW 9 50768668 unclassified probably benign
R4789:Fdxacb1 UTSW 9 50770118 missense possibly damaging 0.84
R4935:Fdxacb1 UTSW 9 50771943 missense probably benign 0.00
R5190:Fdxacb1 UTSW 9 50772087 missense possibly damaging 0.78
R5652:Fdxacb1 UTSW 9 50768405 missense probably damaging 1.00
R6130:Fdxacb1 UTSW 9 50772602 nonsense probably null
R7483:Fdxacb1 UTSW 9 50770151 missense possibly damaging 0.89
R7487:Fdxacb1 UTSW 9 50770219 missense possibly damaging 0.88
R7571:Fdxacb1 UTSW 9 50771793 missense probably damaging 0.98
R8069:Fdxacb1 UTSW 9 50768835 missense probably damaging 1.00
R8201:Fdxacb1 UTSW 9 50770155 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCGTCATCACTTAGTGCC -3'
(R):5'- TTGGGTTGCCAACAATGCAG -3'

Sequencing Primer
(F):5'- CATCACTTAGTGCCGGGTG -3'
(R):5'- TTGCCAACAATGCAGCCCAG -3'
Posted On2014-12-29