Incidental Mutation 'R2914:Cryl1'
ID254816
Institutional Source Beutler Lab
Gene Symbol Cryl1
Ensembl Gene ENSMUSG00000021947
Gene Namecrystallin, lambda 1
SynonymsA230106J09Rik, 1110025H08Rik
MMRRC Submission 040501-MU
Accession Numbers

Genbank: NM_030004; Ensembl: ENSMUST00000089502

Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57274993-57398529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57275918 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 282 (E282G)
Ref Sequence ENSEMBL: ENSMUSP00000022517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022517]
Predicted Effect probably benign
Transcript: ENSMUST00000022517
AA Change: E282G

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022517
Gene: ENSMUSG00000021947
AA Change: E282G

DomainStartEndE-ValueType
Pfam:3HCDH_N 8 190 3.4e-53 PFAM
Pfam:3HCDH 192 282 8.9e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The uronate cycle functions as an alternative glucose metabolic pathway, accounting for about 5% of daily glucose catabolism. The product of this gene catalyzes the dehydrogenation of L-gulonate into dehydro-L-gulonate in the uronate cycle. The enzyme requires NAD(H) as a coenzyme, and is inhibited by inorganic phosphate. A similar gene in the rabbit is thought to serve a structural role in the lens of the eye. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Cryl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Cryl1 APN 14 57286364 critical splice donor site probably null
IGL02117:Cryl1 APN 14 57286447 missense probably damaging 1.00
IGL02556:Cryl1 APN 14 57276021 missense probably benign 0.00
IGL02749:Cryl1 APN 14 57303724 missense probably benign 0.03
IGL03108:Cryl1 APN 14 57313077 missense probably damaging 1.00
G5030:Cryl1 UTSW 14 57342138 intron probably benign
R0391:Cryl1 UTSW 14 57303775 missense possibly damaging 0.94
R2087:Cryl1 UTSW 14 57275945 missense possibly damaging 0.84
R2155:Cryl1 UTSW 14 57398423 missense unknown
R2263:Cryl1 UTSW 14 57286408 nonsense probably null
R2913:Cryl1 UTSW 14 57275918 missense probably benign 0.19
R4747:Cryl1 UTSW 14 57313102 missense probably damaging 1.00
R5482:Cryl1 UTSW 14 57313012 missense probably damaging 0.99
R5977:Cryl1 UTSW 14 57382779 missense probably benign 0.02
R6792:Cryl1 UTSW 14 57382767 missense probably damaging 0.97
R7134:Cryl1 UTSW 14 57275499 missense probably benign
R7409:Cryl1 UTSW 14 57286385 missense probably damaging 1.00
R7522:Cryl1 UTSW 14 57275971 missense probably benign
R7653:Cryl1 UTSW 14 57303691 missense probably benign 0.01
R7711:Cryl1 UTSW 14 57275556 missense probably benign 0.01
R7785:Cryl1 UTSW 14 57275481 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGTCAAAACGAGCTGCTGG -3'
(R):5'- CCCAGGATAGACTCTTCTGCAG -3'

Sequencing Primer
(F):5'- GCTGGTCGCCATCACCTTG -3'
(R):5'- CTTCTGCAGAGGTCTCAGCTG -3'
Posted On2014-12-29