Incidental Mutation 'R2914:Snx29'
ID254819
Institutional Source Beutler Lab
Gene Symbol Snx29
Ensembl Gene ENSMUSG00000071669
Gene Namesorting nexin 29
Synonyms4933437K13Rik, LOC381035, LOC385605, Gm11170, Rundc2a
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location11322908-11755472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11447453 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 516 (R516W)
Ref Sequence ENSEMBL: ENSMUSP00000138025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096273] [ENSMUST00000122168] [ENSMUST00000150993] [ENSMUST00000180792]
Predicted Effect probably damaging
Transcript: ENSMUST00000096273
AA Change: R174W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093993
Gene: ENSMUSG00000071669
AA Change: R174W

DomainStartEndE-ValueType
low complexity region 103 120 N/A INTRINSIC
coiled coil region 125 206 N/A INTRINSIC
PX 319 422 3.13e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122168
AA Change: R159W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113595
Gene: ENSMUSG00000071669
AA Change: R159W

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
coiled coil region 110 191 N/A INTRINSIC
Blast:PX 301 326 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134941
Predicted Effect probably damaging
Transcript: ENSMUST00000150993
AA Change: R72W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117896
Gene: ENSMUSG00000071669
AA Change: R72W

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
coiled coil region 23 104 N/A INTRINSIC
Blast:PX 217 245 3e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151478
Predicted Effect probably damaging
Transcript: ENSMUST00000180792
AA Change: R516W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669
AA Change: R516W

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Snx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Snx29 APN 16 11403502 missense probably damaging 0.97
IGL02207:Snx29 APN 16 11738352 missense probably damaging 1.00
PIT1430001:Snx29 UTSW 16 11403624 missense probably benign 0.00
PIT4810001:Snx29 UTSW 16 11400981 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0276:Snx29 UTSW 16 11738373 missense probably benign 0.01
R0506:Snx29 UTSW 16 11395303 missense probably benign 0.15
R0621:Snx29 UTSW 16 11405787 splice site probably null
R0975:Snx29 UTSW 16 11347871 missense possibly damaging 0.66
R1225:Snx29 UTSW 16 11420686 intron probably benign
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1452:Snx29 UTSW 16 11631471 missense probably damaging 1.00
R1515:Snx29 UTSW 16 11399837 critical splice donor site probably null
R1874:Snx29 UTSW 16 11367681 missense probably benign 0.01
R1953:Snx29 UTSW 16 11399783 nonsense probably null
R1978:Snx29 UTSW 16 11367724 missense probably benign 0.23
R2054:Snx29 UTSW 16 11631492 missense probably damaging 1.00
R2105:Snx29 UTSW 16 11511034 missense possibly damaging 0.72
R2128:Snx29 UTSW 16 11400971 missense probably damaging 0.98
R2152:Snx29 UTSW 16 11400843 missense possibly damaging 0.95
R2912:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2913:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R4468:Snx29 UTSW 16 11420701 splice site probably null
R4469:Snx29 UTSW 16 11420701 splice site probably null
R4612:Snx29 UTSW 16 11447495 missense probably damaging 0.99
R4744:Snx29 UTSW 16 11349909 nonsense probably null
R4798:Snx29 UTSW 16 11420736 missense probably damaging 1.00
R5000:Snx29 UTSW 16 11403507 missense probably damaging 0.99
R5165:Snx29 UTSW 16 11420775 missense probably damaging 0.98
R5207:Snx29 UTSW 16 11738363 missense probably damaging 1.00
R5235:Snx29 UTSW 16 11413246 missense possibly damaging 0.94
R5274:Snx29 UTSW 16 11738404 missense probably damaging 1.00
R5277:Snx29 UTSW 16 11399824 missense possibly damaging 0.82
R5462:Snx29 UTSW 16 11511012 missense possibly damaging 0.89
R5655:Snx29 UTSW 16 11755321 missense probably damaging 1.00
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6326:Snx29 UTSW 16 11403566 missense probably benign
R6576:Snx29 UTSW 16 11715056 critical splice donor site probably null
R7406:Snx29 UTSW 16 11755316 missense probably damaging 1.00
R7552:Snx29 UTSW 16 11420785 critical splice donor site probably null
R7555:Snx29 UTSW 16 11400942 missense probably benign 0.02
R7736:Snx29 UTSW 16 11367724 missense probably benign 0.23
R7962:Snx29 UTSW 16 11413357 critical splice donor site probably null
R8101:Snx29 UTSW 16 11571716 missense probably benign 0.16
R8415:Snx29 UTSW 16 11447427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGTTGGTGCAGAGCC -3'
(R):5'- CACAACTGTAGCTTCCTTTGG -3'

Sequencing Primer
(F):5'- CCTGTGGGCAGTGATGAGC -3'
(R):5'- GCTGGCACATGCTTGCAATC -3'
Posted On2014-12-29