Incidental Mutation 'R2914:Mapk4'
ID254822
Institutional Source Beutler Lab
Gene Symbol Mapk4
Ensembl Gene ENSMUSG00000024558
Gene Namemitogen-activated protein kinase 4
SynonymsErk3-related, p63Mapk
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location73928486-74065359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73935165 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 232 (A232T)
Ref Sequence ENSEMBL: ENSMUSP00000089462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091851] [ENSMUST00000159162] [ENSMUST00000162863]
Predicted Effect probably benign
Transcript: ENSMUST00000091851
AA Change: A232T

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089462
Gene: ENSMUSG00000024558
AA Change: A232T

DomainStartEndE-ValueType
S_TKc 20 312 3.81e-79 SMART
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159162
SMART Domains Protein: ENSMUSP00000123922
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 232 2.3e-58 PFAM
Pfam:Pkinase_Tyr 22 232 5.5e-30 PFAM
Predicted Effect silent
Transcript: ENSMUST00000162863
SMART Domains Protein: ENSMUSP00000124408
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 192 1.7e-41 PFAM
Pfam:Pkinase_Tyr 22 189 5.9e-25 PFAM
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase 4 is a member of the mitogen-activated protein kinase family. Tyrosine kinase growth factor receptors activate mitogen-activated protein kinases which then translocate into the nucleus and phosphorylate nuclear targets. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viabel and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dbn1 A G 13: 55,482,421 F45L probably damaging Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Mapk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02396:Mapk4 APN 18 73933997 splice site probably null
IGL02621:Mapk4 APN 18 73970275 missense probably damaging 1.00
IGL03068:Mapk4 APN 18 73970344 missense probably damaging 1.00
R0041:Mapk4 UTSW 18 73935038 missense probably damaging 1.00
R0519:Mapk4 UTSW 18 73970321 missense probably damaging 1.00
R0636:Mapk4 UTSW 18 73930454 missense probably benign
R0918:Mapk4 UTSW 18 73970337 missense probably damaging 1.00
R1654:Mapk4 UTSW 18 73930939 missense probably damaging 1.00
R2913:Mapk4 UTSW 18 73935165 missense probably benign 0.34
R4089:Mapk4 UTSW 18 73930459 missense probably damaging 1.00
R4414:Mapk4 UTSW 18 73930538 missense possibly damaging 0.76
R4487:Mapk4 UTSW 18 73930975 missense probably damaging 1.00
R4792:Mapk4 UTSW 18 73937250 missense probably damaging 0.98
R5445:Mapk4 UTSW 18 73931002 missense probably benign 0.00
R5597:Mapk4 UTSW 18 73937270 missense probably benign 0.12
R5654:Mapk4 UTSW 18 73970294 missense probably damaging 1.00
R6700:Mapk4 UTSW 18 73930811 missense probably damaging 1.00
R6793:Mapk4 UTSW 18 73930468 missense probably damaging 1.00
R7200:Mapk4 UTSW 18 73930919 missense possibly damaging 0.92
R7335:Mapk4 UTSW 18 73937267 missense possibly damaging 0.75
R8010:Mapk4 UTSW 18 73930576 missense probably benign 0.04
R8269:Mapk4 UTSW 18 73930551 missense probably damaging 0.99
Z1176:Mapk4 UTSW 18 73937184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGACATTAAAGCCAGAG -3'
(R):5'- CCCAGAAGCAAATCAGTGGTG -3'

Sequencing Primer
(F):5'- TGACATTAAAGCCAGAGCCCAG -3'
(R):5'- TGGAGTGAATATTAGACCCCCAGTC -3'
Posted On2014-12-29