Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Col5a2'

254824

Institutional Source

Beutler Lab

Gene Symbol

Col5a2

Ensembl Gene

ENSMUSG00000026042

Gene Name

collagen, type V, alpha 2

Synonyms

1110014L14Rik

MMRRC Submission

040502-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45374321-45503282 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 45413496 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 358 (G358R)

Ref Sequence

ENSEMBL: ENSMUSP00000083620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086430]

AlphaFold

Q3U962

Predicted Effect

probably damaging
Transcript: ENSMUST00000086430
AA Change: G358R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: G358R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
VWC	40	95	9.94e-23	SMART
Pfam:Collagen	123	186	1.5e-10	PFAM
Pfam:Collagen	207	272	2.9e-9	PFAM
low complexity region	319	347	N/A	INTRINSIC
internal_repeat_1	349	421	3.18e-18	PROSPERO
internal_repeat_2	385	422	1.34e-12	PROSPERO
internal_repeat_5	388	423	1.55e-7	PROSPERO
low complexity region	424	460	N/A	INTRINSIC
low complexity region	471	508	N/A	INTRINSIC
internal_repeat_6	509	535	5.68e-7	PROSPERO
internal_repeat_2	511	548	1.34e-12	PROSPERO
internal_repeat_3	520	549	1.16e-11	PROSPERO
internal_repeat_1	520	571	3.18e-18	PROSPERO
internal_repeat_4	546	574	4.91e-9	PROSPERO
low complexity region	595	611	N/A	INTRINSIC
internal_repeat_7	616	741	1.35e-6	PROSPERO
low complexity region	742	757	N/A	INTRINSIC
Pfam:Collagen	790	870	4.8e-8	PFAM
low complexity region	877	898	N/A	INTRINSIC
Pfam:Collagen	907	979	4.2e-8	PFAM
internal_repeat_4	993	1021	4.91e-9	PROSPERO
internal_repeat_3	994	1023	1.16e-11	PROSPERO
low complexity region	1024	1054	N/A	INTRINSIC
internal_repeat_6	1055	1078	5.68e-7	PROSPERO
low complexity region	1081	1096	N/A	INTRINSIC
Pfam:Collagen	1111	1171	9.7e-12	PFAM
Pfam:Collagen	1168	1230	1.4e-9	PFAM
COLFI	1263	1497	1.83e-164	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131535

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134681

Meta Mutation Damage Score

0.9615

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap11a	A	G	2: 113,833,508	V810A	probably damaging	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Dusp13	T	A	14: 21,740,137	N47I	probably damaging	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gabrb2	T	A	11: 42,591,907	N197K	probably benign	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Rnf20	A	G	4: 49,638,769	E197G	probably benign	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Tyrp1	A	G	4: 80,837,455	T154A	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfhx2	G	T	14: 55,064,557	P1990Q	probably damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Col5a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Col5a2	APN	1	45392877	splice site	probably benign
IGL00978:Col5a2	APN	1	45376739	missense	probably benign	0.01
IGL01366:Col5a2	APN	1	45391888	missense	possibly damaging	0.46
IGL01487:Col5a2	APN	1	45376739	missense	probably benign	0.01
IGL01820:Col5a2	APN	1	45442825	missense	unknown
IGL01980:Col5a2	APN	1	45382233	splice site	probably benign
IGL02063:Col5a2	APN	1	45403419	critical splice donor site	probably null
IGL02134:Col5a2	APN	1	45391070	splice site	probably null
IGL02233:Col5a2	APN	1	45383587	splice site	probably null
IGL02489:Col5a2	APN	1	45392811	splice site	probably null
IGL02928:Col5a2	APN	1	45385020	missense	probably benign	0.41
IGL02931:Col5a2	APN	1	45385065	missense	probably damaging	1.00
IGL03328:Col5a2	APN	1	45376146	missense	possibly damaging	0.94
Beatnik	UTSW	1	45376778	missense	probably damaging	0.99
R0022:Col5a2	UTSW	1	45383683	nonsense	probably null
R0123:Col5a2	UTSW	1	45407035	missense	probably benign	0.28
R0180:Col5a2	UTSW	1	45411460	missense	probably damaging	1.00
R0225:Col5a2	UTSW	1	45407035	missense	probably benign	0.28
R0455:Col5a2	UTSW	1	45382102	splice site	probably benign
R0485:Col5a2	UTSW	1	45378482	missense	probably damaging	0.99
R0702:Col5a2	UTSW	1	45380131	missense	possibly damaging	0.54
R0745:Col5a2	UTSW	1	45407227	splice site	probably null
R1147:Col5a2	UTSW	1	45376771	missense	probably damaging	0.99
R1147:Col5a2	UTSW	1	45376771	missense	probably damaging	0.99
R1394:Col5a2	UTSW	1	45403419	critical splice donor site	probably null
R1494:Col5a2	UTSW	1	45502914	start codon destroyed	unknown
R1499:Col5a2	UTSW	1	45411466	missense	probably benign	0.00
R1733:Col5a2	UTSW	1	45407032	missense	possibly damaging	0.81
R1789:Col5a2	UTSW	1	45378305	critical splice donor site	probably null
R1789:Col5a2	UTSW	1	45394776	missense	probably damaging	0.98
R2114:Col5a2	UTSW	1	45376804	missense	probably damaging	0.98
R3861:Col5a2	UTSW	1	45380237	missense	probably damaging	0.98
R4015:Col5a2	UTSW	1	45403471	missense	probably benign	0.14
R4944:Col5a2	UTSW	1	45376695	missense	possibly damaging	0.75
R4982:Col5a2	UTSW	1	45389458	missense	possibly damaging	0.88
R5001:Col5a2	UTSW	1	45502898	missense	unknown
R5159:Col5a2	UTSW	1	45386831	critical splice donor site	probably null
R5197:Col5a2	UTSW	1	45393081	missense	probably benign	0.01
R5407:Col5a2	UTSW	1	45406280	missense	possibly damaging	0.54
R5502:Col5a2	UTSW	1	45380126	missense	probably damaging	1.00
R5575:Col5a2	UTSW	1	45378482	missense	probably damaging	0.99
R5622:Col5a2	UTSW	1	45427059	missense	probably benign
R5643:Col5a2	UTSW	1	45390042	missense	probably damaging	1.00
R5801:Col5a2	UTSW	1	45389481	critical splice acceptor site	probably null
R6075:Col5a2	UTSW	1	45502848	missense	unknown
R6211:Col5a2	UTSW	1	45376666	missense	probably damaging	0.99
R6407:Col5a2	UTSW	1	45376778	missense	probably damaging	0.99
R6494:Col5a2	UTSW	1	45378327	missense	probably damaging	0.99
R6582:Col5a2	UTSW	1	45390115	missense	possibly damaging	0.91
R6687:Col5a2	UTSW	1	45383604	missense	probably damaging	1.00
R7007:Col5a2	UTSW	1	45378449	missense	possibly damaging	0.53
R7062:Col5a2	UTSW	1	45417625	missense	probably benign	0.00
R7098:Col5a2	UTSW	1	45380067	missense	possibly damaging	0.48
R7243:Col5a2	UTSW	1	45376160	missense	probably benign	0.39
R7326:Col5a2	UTSW	1	45442867	missense	unknown
R7332:Col5a2	UTSW	1	45380165	missense	probably damaging	1.00
R7642:Col5a2	UTSW	1	45376088	missense	probably benign	0.01
R7890:Col5a2	UTSW	1	45404987	splice site	probably null
R8066:Col5a2	UTSW	1	45413468	critical splice donor site	probably null
R8375:Col5a2	UTSW	1	45442730	missense	unknown
R8444:Col5a2	UTSW	1	45396145	missense	probably benign	0.06
R8506:Col5a2	UTSW	1	45442784	missense	unknown
R8686:Col5a2	UTSW	1	45421987	missense	probably damaging	1.00
R8907:Col5a2	UTSW	1	45416946	missense	probably benign	0.27
R8932:Col5a2	UTSW	1	45380146	missense	probably benign	0.00
R8933:Col5a2	UTSW	1	45421963	missense
R9087:Col5a2	UTSW	1	45442658	missense	unknown
R9105:Col5a2	UTSW	1	45380206	missense	probably benign	0.00
R9282:Col5a2	UTSW	1	45438869	critical splice donor site	probably null
R9457:Col5a2	UTSW	1	45386844	missense	probably benign	0.00
R9457:Col5a2	UTSW	1	45392813	critical splice donor site	probably null
R9568:Col5a2	UTSW	1	45391838	missense	possibly damaging	0.89
R9727:Col5a2	UTSW	1	45376658	missense	possibly damaging	0.50
X0013:Col5a2	UTSW	1	45403258	critical splice donor site	probably null
Z1176:Col5a2	UTSW	1	45376146	missense	possibly damaging	0.94
Z1176:Col5a2	UTSW	1	45383680	missense	probably damaging	1.00
Z1176:Col5a2	UTSW	1	45396484	missense	probably benign	0.11
Z1177:Col5a2	UTSW	1	45402113	missense	probably damaging	1.00
Z1177:Col5a2	UTSW	1	45403473	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAGATTTAAGCACATCCTCCTC -3'
(R):5'- GGGTTTACCTGACACAGCATG -3'

Sequencing Primer
(F):5'- TTCACTCTACACAACAGCATTAATAG -3'
(R):5'- GGTTTACCTGACACAGCATGATACAG -3'

Posted On

2014-12-29