Incidental Mutation 'R2915:Or5t9'
ID 254828
Institutional Source Beutler Lab
Gene Symbol Or5t9
Ensembl Gene ENSMUSG00000044213
Gene Name olfactory receptor family 5 subfamily T member 9
Synonyms Olfr1094, GA_x6K02T2Q125-48321457-48322449, MOR179-7
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 86659020-86660166 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86659570 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 158 (I158T)
Ref Sequence ENSEMBL: ENSMUSP00000148902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105211] [ENSMUST00000217509]
AlphaFold Q8VF13
Predicted Effect probably benign
Transcript: ENSMUST00000105211
AA Change: I158T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000100846
Gene: ENSMUSG00000044213
AA Change: I158T

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 4.6e-52 PFAM
Pfam:7tm_1 53 316 3.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217509
AA Change: I158T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Dusp13b T A 14: 21,790,205 (GRCm39) N47I probably damaging Het
Elmo2 A G 2: 165,139,573 (GRCm39) probably benign Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gabrb2 T A 11: 42,482,734 (GRCm39) N197K probably benign Het
Gdnf T A 15: 7,845,130 (GRCm39) V41E possibly damaging Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Ice2 A G 9: 69,318,122 (GRCm39) D241G probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pax1 A G 2: 147,210,348 (GRCm39) Y361C probably damaging Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zfp853 T C 5: 143,275,332 (GRCm39) E96G unknown Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Or5t9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Or5t9 APN 2 86,659,712 (GRCm39) missense probably benign
IGL03053:Or5t9 APN 2 86,659,607 (GRCm39) missense possibly damaging 0.93
IGL03168:Or5t9 APN 2 86,659,607 (GRCm39) missense possibly damaging 0.93
IGL02799:Or5t9 UTSW 2 86,659,300 (GRCm39) missense probably damaging 0.99
R0511:Or5t9 UTSW 2 86,659,950 (GRCm39) missense probably benign 0.02
R0944:Or5t9 UTSW 2 86,659,281 (GRCm39) missense probably benign 0.01
R1065:Or5t9 UTSW 2 86,659,888 (GRCm39) missense probably damaging 0.98
R1476:Or5t9 UTSW 2 86,659,542 (GRCm39) missense probably benign 0.31
R1807:Or5t9 UTSW 2 86,659,445 (GRCm39) missense probably benign 0.03
R2865:Or5t9 UTSW 2 86,659,198 (GRCm39) missense probably benign 0.21
R3055:Or5t9 UTSW 2 86,659,471 (GRCm39) missense possibly damaging 0.94
R3104:Or5t9 UTSW 2 86,660,035 (GRCm39) missense probably benign 0.03
R4862:Or5t9 UTSW 2 86,659,876 (GRCm39) missense probably damaging 1.00
R4874:Or5t9 UTSW 2 86,659,598 (GRCm39) missense probably damaging 0.98
R5505:Or5t9 UTSW 2 86,659,845 (GRCm39) missense possibly damaging 0.88
R5507:Or5t9 UTSW 2 86,659,661 (GRCm39) missense probably damaging 1.00
R6318:Or5t9 UTSW 2 86,659,998 (GRCm39) missense possibly damaging 0.73
R6538:Or5t9 UTSW 2 86,659,869 (GRCm39) missense possibly damaging 0.55
R8058:Or5t9 UTSW 2 86,660,052 (GRCm39) missense probably benign 0.01
R8285:Or5t9 UTSW 2 86,659,443 (GRCm39) missense probably benign 0.03
R9563:Or5t9 UTSW 2 86,659,098 (GRCm39) start codon destroyed probably null 0.04
Predicted Primers PCR Primer
(F):5'- TGTCACTCCGAAGATGTTGG -3'
(R):5'- TGATGATCTCAATGGAGCCTACAC -3'

Sequencing Primer
(F):5'- CCGAAGATGTTGGTCAATTTTATTTC -3'
(R):5'- TGATCTCAATGGAGCCTACACAATAG -3'
Posted On 2014-12-29