Incidental Mutation 'R0318:Olfr995'
ID25483
Institutional Source Beutler Lab
Gene Symbol Olfr995
Ensembl Gene ENSMUSG00000075218
Gene Nameolfactory receptor 995
SynonymsGA_x6K02T2Q125-46915844-46914897, MOR203-3
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0318 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85437528-85443639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85438237 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 307 (R307M)
Ref Sequence ENSEMBL: ENSMUSP00000149952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099924] [ENSMUST00000214679] [ENSMUST00000216933] [ENSMUST00000217218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099924
AA Change: R307M

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097508
Gene: ENSMUSG00000075218
AA Change: R307M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-50 PFAM
Pfam:7tm_1 41 290 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215758
Predicted Effect possibly damaging
Transcript: ENSMUST00000216933
AA Change: R307M

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000217218
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
Blk A G 14: 63,374,197 Y430H probably damaging Het
C3 C T 17: 57,224,709 V272M probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Chaf1a C T 17: 56,062,227 T486I possibly damaging Het
Colec12 A G 18: 9,848,446 N208S possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Mapkapk2 A G 1: 131,097,335 V64A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Smg9 T C 7: 24,420,888 F429S possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Veph1 G T 3: 66,057,259 S783Y probably damaging Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in Olfr995
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02102:Olfr995 APN 2 85438267 missense probably damaging 1.00
IGL02540:Olfr995 APN 2 85438915 missense probably benign 0.05
IGL02687:Olfr995 APN 2 85438586 missense possibly damaging 0.93
IGL02713:Olfr995 APN 2 85438637 missense probably damaging 0.99
R0463:Olfr995 UTSW 2 85438286 missense probably damaging 1.00
R0638:Olfr995 UTSW 2 85438501 missense probably benign 0.03
R1668:Olfr995 UTSW 2 85438876 missense probably benign 0.00
R1718:Olfr995 UTSW 2 85438805 missense probably benign 0.39
R4981:Olfr995 UTSW 2 85438469 missense probably damaging 1.00
R5261:Olfr995 UTSW 2 85438897 missense probably benign
R7036:Olfr995 UTSW 2 85438430 missense probably damaging 1.00
R7899:Olfr995 UTSW 2 85438397 missense probably benign 0.39
R7982:Olfr995 UTSW 2 85438397 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCCATGTACCCCTCAGTGAATTTCTGTA -3'
(R):5'- CCACCTGACAGCAGTCACCATCTT -3'

Sequencing Primer
(F):5'- actccaccttctatcagcattc -3'
(R):5'- GACAGCAGTCACCATCTTCTATG -3'
Posted On2013-04-16