Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Arhgap11a'

254830

Institutional Source

Beutler Lab

Gene Symbol

Arhgap11a

Ensembl Gene

ENSMUSG00000041219

Gene Name

Rho GTPase activating protein 11A

Synonyms

GAP (1-12), 6530401L14Rik

MMRRC Submission

040502-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113831492-113848661 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113833508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 810 (V810A)

Ref Sequence

ENSEMBL: ENSMUSP00000106574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024005] [ENSMUST00000102545] [ENSMUST00000110947] [ENSMUST00000110948] [ENSMUST00000110949]

AlphaFold

Q80Y19

Predicted Effect

probably benign
Transcript: ENSMUST00000024005

SMART Domains

Protein: ENSMUSP00000024005
Gene: ENSMUSG00000023236

Domain	Start	End	E-Value	Type
Pfam:Secretogranin_V	23	160	4e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102545
AA Change: V810A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099604
Gene: ENSMUSG00000041219
AA Change: V810A

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
RhoGAP	63	236	1.97e-47	SMART
Blast:RhoGAP	288	349	3e-20	BLAST
low complexity region	490	501	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110947

SMART Domains

Protein: ENSMUSP00000106572
Gene: ENSMUSG00000041219

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
RhoGAP	63	236	1.97e-47	SMART
Blast:RhoGAP	288	349	7e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000110948

SMART Domains

Protein: ENSMUSP00000106573
Gene: ENSMUSG00000041219

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
RhoGAP	63	236	1.97e-47	SMART
Blast:RhoGAP	288	349	6e-21	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000110949
AA Change: V810A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106574
Gene: ENSMUSG00000041219
AA Change: V810A

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
RhoGAP	63	236	1.97e-47	SMART
Blast:RhoGAP	288	349	3e-20	BLAST
low complexity region	490	501	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139975

Meta Mutation Damage Score

0.2970

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase activating protein family. In response to DNA damage, the encoded protein interacts with the p53 tumor suppressor protein and stimulates its tetramerization, which results in cell-cycle arrest and apoptosis. A chromosomal deletion that includes this gene is one cause of Prader-Willi syndrome, and an intronic variant of this gene may be associated with sleep duration in children. This gene is highly expressed in colon cancers and in a human basal-like breast cancer cell line. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Col5a2	C	G	1: 45,413,496	G358R	probably damaging	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Dusp13	T	A	14: 21,740,137	N47I	probably damaging	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gabrb2	T	A	11: 42,591,907	N197K	probably benign	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Rnf20	A	G	4: 49,638,769	E197G	probably benign	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Tyrp1	A	G	4: 80,837,455	T154A	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfhx2	G	T	14: 55,064,557	P1990Q	probably damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Arhgap11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Arhgap11a	APN	2	113834256	missense	probably benign	0.00
IGL00337:Arhgap11a	APN	2	113841942	missense	probably damaging	0.96
IGL00532:Arhgap11a	APN	2	113834066	missense	probably benign
IGL00869:Arhgap11a	APN	2	113834826	missense	probably damaging	0.99
IGL01123:Arhgap11a	APN	2	113834773	splice site	probably benign
IGL01353:Arhgap11a	APN	2	113833524	missense	probably damaging	1.00
IGL01725:Arhgap11a	APN	2	113837552	missense	probably damaging	0.98
IGL01911:Arhgap11a	APN	2	113840732	missense	probably damaging	1.00
IGL02077:Arhgap11a	APN	2	113837471	missense	possibly damaging	0.94
IGL02532:Arhgap11a	APN	2	113833676	nonsense	probably null
IGL02553:Arhgap11a	APN	2	113837561	splice site	probably benign
IGL02738:Arhgap11a	APN	2	113832975	makesense	probably null
IGL02945:Arhgap11a	APN	2	113837473	missense	possibly damaging	0.83
R0480:Arhgap11a	UTSW	2	113839818	missense	probably benign	0.03
R0515:Arhgap11a	UTSW	2	113837471	missense	possibly damaging	0.48
R0625:Arhgap11a	UTSW	2	113841711	missense	probably benign	0.01
R0898:Arhgap11a	UTSW	2	113836876	missense	probably benign	0.01
R1248:Arhgap11a	UTSW	2	113834102	missense	possibly damaging	0.63
R1395:Arhgap11a	UTSW	2	113833122	missense	probably benign	0.00
R1669:Arhgap11a	UTSW	2	113841912	missense	possibly damaging	0.92
R3941:Arhgap11a	UTSW	2	113836897	missense	probably damaging	1.00
R4194:Arhgap11a	UTSW	2	113841994	missense	probably benign	0.02
R4508:Arhgap11a	UTSW	2	113842042	missense	probably damaging	1.00
R4617:Arhgap11a	UTSW	2	113834078	missense	probably benign	0.01
R4839:Arhgap11a	UTSW	2	113842029	missense	probably damaging	1.00
R4842:Arhgap11a	UTSW	2	113839762	missense	probably damaging	0.98
R5507:Arhgap11a	UTSW	2	113841678	missense	probably benign
R5538:Arhgap11a	UTSW	2	113837530	missense	probably benign
R5660:Arhgap11a	UTSW	2	113841910	missense	possibly damaging	0.80
R5712:Arhgap11a	UTSW	2	113845301	missense	probably benign	0.09
R5849:Arhgap11a	UTSW	2	113834847	missense	probably null	0.01
R5856:Arhgap11a	UTSW	2	113833771	missense	possibly damaging	0.63
R6101:Arhgap11a	UTSW	2	113834874	nonsense	probably null
R6119:Arhgap11a	UTSW	2	113834350	missense	probably benign
R6338:Arhgap11a	UTSW	2	113833725	missense	probably benign	0.37
R6563:Arhgap11a	UTSW	2	113833902	missense	probably benign	0.00
R6919:Arhgap11a	UTSW	2	113839709	missense	possibly damaging	0.94
R7798:Arhgap11a	UTSW	2	113843335	missense	probably damaging	0.98
R7819:Arhgap11a	UTSW	2	113834918	critical splice acceptor site	probably null
R8208:Arhgap11a	UTSW	2	113842939	missense	probably benign	0.10
R8806:Arhgap11a	UTSW	2	113834762	missense	possibly damaging	0.96
R9026:Arhgap11a	UTSW	2	113834066	missense	probably benign	0.01
R9150:Arhgap11a	UTSW	2	113843269	missense	possibly damaging	0.81
R9428:Arhgap11a	UTSW	2	113836934	missense	probably benign
R9578:Arhgap11a	UTSW	2	113839780	missense	possibly damaging	0.95
X0065:Arhgap11a	UTSW	2	113834231	missense	probably benign	0.41
Z1088:Arhgap11a	UTSW	2	113842894	missense	probably damaging	1.00
Z1176:Arhgap11a	UTSW	2	113833758	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- AAGACGTAGACTTCTGTGCTTC -3'
(R):5'- TGTGGCGGTCCTTTCGAAAC -3'

Sequencing Primer
(F):5'- CTTCGAGGCCTGACGTGATAAG -3'
(R):5'- GGTCCTTTCGAAACCTCGG -3'

Posted On

2014-12-29