Incidental Mutation 'R2915:Arhgap11a'
ID254830
Institutional Source Beutler Lab
Gene Symbol Arhgap11a
Ensembl Gene ENSMUSG00000041219
Gene NameRho GTPase activating protein 11A
SynonymsGAP (1-12), 6530401L14Rik
MMRRC Submission 040502-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2915 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location113831492-113848661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113833508 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 810 (V810A)
Ref Sequence ENSEMBL: ENSMUSP00000106574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024005] [ENSMUST00000102545] [ENSMUST00000110947] [ENSMUST00000110948] [ENSMUST00000110949]
Predicted Effect probably benign
Transcript: ENSMUST00000024005
SMART Domains Protein: ENSMUSP00000024005
Gene: ENSMUSG00000023236

DomainStartEndE-ValueType
Pfam:Secretogranin_V 23 160 4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102545
AA Change: V810A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099604
Gene: ENSMUSG00000041219
AA Change: V810A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110947
SMART Domains Protein: ENSMUSP00000106572
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 7e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110948
SMART Domains Protein: ENSMUSP00000106573
Gene: ENSMUSG00000041219

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 6e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000110949
AA Change: V810A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106574
Gene: ENSMUSG00000041219
AA Change: V810A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
RhoGAP 63 236 1.97e-47 SMART
Blast:RhoGAP 288 349 3e-20 BLAST
low complexity region 490 501 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139975
Meta Mutation Damage Score 0.2970 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase activating protein family. In response to DNA damage, the encoded protein interacts with the p53 tumor suppressor protein and stimulates its tetramerization, which results in cell-cycle arrest and apoptosis. A chromosomal deletion that includes this gene is one cause of Prader-Willi syndrome, and an intronic variant of this gene may be associated with sleep duration in children. This gene is highly expressed in colon cancers and in a human basal-like breast cancer cell line. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Arhgap11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Arhgap11a APN 2 113834256 missense probably benign 0.00
IGL00337:Arhgap11a APN 2 113841942 missense probably damaging 0.96
IGL00532:Arhgap11a APN 2 113834066 missense probably benign
IGL00869:Arhgap11a APN 2 113834826 missense probably damaging 0.99
IGL01123:Arhgap11a APN 2 113834773 splice site probably benign
IGL01353:Arhgap11a APN 2 113833524 missense probably damaging 1.00
IGL01725:Arhgap11a APN 2 113837552 missense probably damaging 0.98
IGL01911:Arhgap11a APN 2 113840732 missense probably damaging 1.00
IGL02077:Arhgap11a APN 2 113837471 missense possibly damaging 0.94
IGL02532:Arhgap11a APN 2 113833676 nonsense probably null
IGL02553:Arhgap11a APN 2 113837561 splice site probably benign
IGL02738:Arhgap11a APN 2 113832975 makesense probably null
IGL02945:Arhgap11a APN 2 113837473 missense possibly damaging 0.83
R0480:Arhgap11a UTSW 2 113839818 missense probably benign 0.03
R0515:Arhgap11a UTSW 2 113837471 missense possibly damaging 0.48
R0625:Arhgap11a UTSW 2 113841711 missense probably benign 0.01
R0898:Arhgap11a UTSW 2 113836876 missense probably benign 0.01
R1248:Arhgap11a UTSW 2 113834102 missense possibly damaging 0.63
R1395:Arhgap11a UTSW 2 113833122 missense probably benign 0.00
R1669:Arhgap11a UTSW 2 113841912 missense possibly damaging 0.92
R3941:Arhgap11a UTSW 2 113836897 missense probably damaging 1.00
R4194:Arhgap11a UTSW 2 113841994 missense probably benign 0.02
R4508:Arhgap11a UTSW 2 113842042 missense probably damaging 1.00
R4617:Arhgap11a UTSW 2 113834078 missense probably benign 0.01
R4839:Arhgap11a UTSW 2 113842029 missense probably damaging 1.00
R4842:Arhgap11a UTSW 2 113839762 missense probably damaging 0.98
R5507:Arhgap11a UTSW 2 113841678 missense probably benign
R5538:Arhgap11a UTSW 2 113837530 missense probably benign
R5660:Arhgap11a UTSW 2 113841910 missense possibly damaging 0.80
R5712:Arhgap11a UTSW 2 113845301 missense probably benign 0.09
R5849:Arhgap11a UTSW 2 113834847 missense probably null 0.01
R5856:Arhgap11a UTSW 2 113833771 missense possibly damaging 0.63
R6101:Arhgap11a UTSW 2 113834874 nonsense probably null
R6119:Arhgap11a UTSW 2 113834350 missense probably benign
R6338:Arhgap11a UTSW 2 113833725 missense probably benign 0.37
R6563:Arhgap11a UTSW 2 113833902 missense probably benign 0.00
R6919:Arhgap11a UTSW 2 113839709 missense possibly damaging 0.94
R7798:Arhgap11a UTSW 2 113843335 missense probably damaging 0.98
R7819:Arhgap11a UTSW 2 113834918 critical splice acceptor site probably null
R8208:Arhgap11a UTSW 2 113842939 missense probably benign 0.10
X0065:Arhgap11a UTSW 2 113834231 missense probably benign 0.41
Z1088:Arhgap11a UTSW 2 113842894 missense probably damaging 1.00
Z1176:Arhgap11a UTSW 2 113833758 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AAGACGTAGACTTCTGTGCTTC -3'
(R):5'- TGTGGCGGTCCTTTCGAAAC -3'

Sequencing Primer
(F):5'- CTTCGAGGCCTGACGTGATAAG -3'
(R):5'- GGTCCTTTCGAAACCTCGG -3'
Posted On2014-12-29