Incidental Mutation 'R2915:Pax1'
ID 254831
Institutional Source Beutler Lab
Gene Symbol Pax1
Ensembl Gene ENSMUSG00000037034
Gene Name paired box 1
Synonyms hunchback, wavy tail, hbs, wt, Pax-1
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.730) question?
Stock # R2915 (G1)
Quality Score 216
Status Validated
Chromosome 2
Chromosomal Location 147203850-147216972 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 147210348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 361 (Y361C)
Ref Sequence ENSEMBL: ENSMUSP00000105594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109968] [ENSMUST00000126068]
AlphaFold P09084
Predicted Effect probably damaging
Transcript: ENSMUST00000109968
AA Change: Y361C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105594
Gene: ENSMUSG00000037034
AA Change: Y361C

DomainStartEndE-ValueType
low complexity region 9 55 N/A INTRINSIC
PAX 89 213 9.13e-91 SMART
low complexity region 380 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126068
SMART Domains Protein: ENSMUSP00000119667
Gene: ENSMUSG00000037034

DomainStartEndE-ValueType
low complexity region 97 143 N/A INTRINSIC
PAX 177 301 9.13e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156584
Meta Mutation Damage Score 0.3894 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. This gene plays a role in pattern formation during embryogenesis and may be essential for development of the vertebral column. This gene is silenced by methylation in ovarian and cervical cancers and may be a tumor suppressor gene. Mutations in this gene are also associated with vertebral malformations. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for several mutations exhibit variably severe morphological alterations of vertebral column, sternum, scapula, skull, and thymus, with reduced adult survival and fertility. Some heterozygotes show milder skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Dusp13b T A 14: 21,790,205 (GRCm39) N47I probably damaging Het
Elmo2 A G 2: 165,139,573 (GRCm39) probably benign Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gabrb2 T A 11: 42,482,734 (GRCm39) N197K probably benign Het
Gdnf T A 15: 7,845,130 (GRCm39) V41E possibly damaging Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Ice2 A G 9: 69,318,122 (GRCm39) D241G probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or5t9 T C 2: 86,659,570 (GRCm39) I158T probably benign Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zfp853 T C 5: 143,275,332 (GRCm39) E96G unknown Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Pax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
wavy UTSW 2 147,207,722 (GRCm39) missense probably damaging 1.00
R0030:Pax1 UTSW 2 147,210,502 (GRCm39) missense probably damaging 0.99
R0147:Pax1 UTSW 2 147,215,654 (GRCm39) missense probably benign 0.17
R0304:Pax1 UTSW 2 147,208,067 (GRCm39) missense probably benign 0.20
R1544:Pax1 UTSW 2 147,210,321 (GRCm39) missense probably damaging 0.99
R1583:Pax1 UTSW 2 147,208,175 (GRCm39) missense possibly damaging 0.94
R1937:Pax1 UTSW 2 147,209,809 (GRCm39) missense possibly damaging 0.78
R2143:Pax1 UTSW 2 147,207,802 (GRCm39) missense probably damaging 1.00
R2208:Pax1 UTSW 2 147,207,722 (GRCm39) missense probably damaging 1.00
R3878:Pax1 UTSW 2 147,204,228 (GRCm39) unclassified probably benign
R4788:Pax1 UTSW 2 147,208,124 (GRCm39) missense possibly damaging 0.94
R6323:Pax1 UTSW 2 147,210,321 (GRCm39) missense probably damaging 1.00
R6842:Pax1 UTSW 2 147,215,640 (GRCm39) missense probably benign 0.00
R7052:Pax1 UTSW 2 147,207,824 (GRCm39) missense probably damaging 1.00
R7117:Pax1 UTSW 2 147,208,190 (GRCm39) missense probably damaging 0.98
R7703:Pax1 UTSW 2 147,208,034 (GRCm39) missense probably damaging 1.00
R8487:Pax1 UTSW 2 147,206,968 (GRCm39) start codon destroyed probably null
R8958:Pax1 UTSW 2 147,210,517 (GRCm39) critical splice donor site probably null
R9092:Pax1 UTSW 2 147,204,287 (GRCm39) missense unknown
Z1177:Pax1 UTSW 2 147,210,431 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTCGAGTGAAGATTGACATGC -3'
(R):5'- ACCTTCTCGGTGTTTGAAGG -3'

Sequencing Primer
(F):5'- CGAGTGAAGATTGACATGCCTTTC -3'
(R):5'- TGAAGGTCATTGCCGCTGC -3'
Posted On 2014-12-29