Incidental Mutation 'R2915:Elmo2'
ID 254832
Institutional Source Beutler Lab
Gene Symbol Elmo2
Ensembl Gene ENSMUSG00000017670
Gene Name engulfment and cell motility 2
Synonyms CED-12, 1190002F24Rik
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 165129951-165168399 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 165139573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000071699] [ENSMUST00000074046] [ENSMUST00000094329] [ENSMUST00000103088] [ENSMUST00000103091]
AlphaFold Q8BHL5
Predicted Effect probably benign
Transcript: ENSMUST00000071699
SMART Domains Protein: ENSMUSP00000071619
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 115 272 1.6e-61 PFAM
Pfam:ELMO_CED12 295 474 3.2e-39 PFAM
Pfam:PH_12 541 657 5.4e-33 PFAM
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000074046
SMART Domains Protein: ENSMUSP00000073691
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 285 2.7e-75 PFAM
Pfam:ELMO_CED12 304 487 3.7e-48 PFAM
PDB:3A98|D 535 729 3e-99 PDB
SCOP:d1mai__ 552 677 4e-33 SMART
Blast:PH 560 681 2e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000094329
SMART Domains Protein: ENSMUSP00000091887
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000103088
SMART Domains Protein: ENSMUSP00000099377
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 6.6e-77 PFAM
Pfam:ELMO_CED12 292 475 4.3e-48 PFAM
internal_repeat_1 654 672 6.69e-7 PROSPERO
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103091
SMART Domains Protein: ENSMUSP00000099380
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127496
Predicted Effect probably benign
Transcript: ENSMUST00000137188
SMART Domains Protein: ENSMUSP00000123232
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 17 172 1.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148643
SMART Domains Protein: ENSMUSP00000117124
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:ELMO_CED12 2 48 9.6e-10 PFAM
Pfam:PH_12 115 237 1.3e-35 PFAM
low complexity region 270 280 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Dusp13b T A 14: 21,790,205 (GRCm39) N47I probably damaging Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gabrb2 T A 11: 42,482,734 (GRCm39) N197K probably benign Het
Gdnf T A 15: 7,845,130 (GRCm39) V41E possibly damaging Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Ice2 A G 9: 69,318,122 (GRCm39) D241G probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or5t9 T C 2: 86,659,570 (GRCm39) I158T probably benign Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pax1 A G 2: 147,210,348 (GRCm39) Y361C probably damaging Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zfp853 T C 5: 143,275,332 (GRCm39) E96G unknown Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Elmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Elmo2 APN 2 165,133,934 (GRCm39) unclassified probably benign
IGL01096:Elmo2 APN 2 165,138,907 (GRCm39) unclassified probably benign
IGL01694:Elmo2 APN 2 165,156,693 (GRCm39) missense probably benign 0.05
IGL02016:Elmo2 APN 2 165,136,932 (GRCm39) critical splice donor site probably null
IGL02402:Elmo2 APN 2 165,139,312 (GRCm39) missense probably damaging 0.97
IGL02808:Elmo2 APN 2 165,133,627 (GRCm39) unclassified probably benign
IGL03030:Elmo2 APN 2 165,136,237 (GRCm39) missense possibly damaging 0.93
IGL03117:Elmo2 APN 2 165,140,573 (GRCm39) missense probably benign 0.01
R0046:Elmo2 UTSW 2 165,140,646 (GRCm39) missense probably damaging 0.97
R0046:Elmo2 UTSW 2 165,140,646 (GRCm39) missense probably damaging 0.97
R0278:Elmo2 UTSW 2 165,139,287 (GRCm39) missense probably damaging 1.00
R0281:Elmo2 UTSW 2 165,138,810 (GRCm39) missense probably damaging 1.00
R0472:Elmo2 UTSW 2 165,140,250 (GRCm39) missense probably damaging 0.99
R0570:Elmo2 UTSW 2 165,146,839 (GRCm39) missense probably benign 0.38
R1799:Elmo2 UTSW 2 165,134,077 (GRCm39) missense probably damaging 1.00
R1940:Elmo2 UTSW 2 165,133,970 (GRCm39) unclassified probably benign
R2005:Elmo2 UTSW 2 165,140,199 (GRCm39) missense probably benign 0.00
R2504:Elmo2 UTSW 2 165,140,607 (GRCm39) missense probably damaging 0.96
R3744:Elmo2 UTSW 2 165,157,922 (GRCm39) missense probably damaging 0.96
R4027:Elmo2 UTSW 2 165,136,169 (GRCm39) nonsense probably null
R4419:Elmo2 UTSW 2 165,153,675 (GRCm39) splice site probably null
R4824:Elmo2 UTSW 2 165,133,922 (GRCm39) unclassified probably benign
R4888:Elmo2 UTSW 2 165,137,209 (GRCm39) missense probably benign 0.14
R4950:Elmo2 UTSW 2 165,156,733 (GRCm39) splice site probably null
R5157:Elmo2 UTSW 2 165,133,627 (GRCm39) unclassified probably benign
R5535:Elmo2 UTSW 2 165,152,132 (GRCm39) missense possibly damaging 0.51
R5682:Elmo2 UTSW 2 165,139,330 (GRCm39) missense probably damaging 1.00
R5840:Elmo2 UTSW 2 165,137,472 (GRCm39) missense possibly damaging 0.64
R5868:Elmo2 UTSW 2 165,136,192 (GRCm39) missense possibly damaging 0.89
R7022:Elmo2 UTSW 2 165,136,961 (GRCm39) missense probably damaging 0.99
R7089:Elmo2 UTSW 2 165,146,849 (GRCm39) missense possibly damaging 0.78
R7678:Elmo2 UTSW 2 165,133,664 (GRCm39) missense unknown
R8024:Elmo2 UTSW 2 165,133,775 (GRCm39) missense unknown
R8290:Elmo2 UTSW 2 165,150,923 (GRCm39) missense probably damaging 1.00
R9150:Elmo2 UTSW 2 165,140,607 (GRCm39) missense probably damaging 0.96
R9166:Elmo2 UTSW 2 165,132,438 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTCTCCAGCACGATCTACAAG -3'
(R):5'- GGTTAAACACGGCTCAGCTG -3'

Sequencing Primer
(F):5'- AGCACGATCTACAAGCAGAG -3'
(R):5'- ACACGGCTCAGCTGGGAATG -3'
Posted On 2014-12-29