Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Rnf20'

254833

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

040502-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49638769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 197 (E197G)

Ref Sequence

ENSEMBL: ENSMUSP00000118293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000140341] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

probably benign
Transcript: ENSMUST00000029989
AA Change: E197G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: E197G

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132782

Predicted Effect

probably benign
Transcript: ENSMUST00000140341

SMART Domains

Protein: ENSMUSP00000121334
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

probably benign
Transcript: ENSMUST00000156314
AA Change: E197G

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: E197G

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167496
AA Change: E197G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: E197G

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Meta Mutation Damage Score

0.0710

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap11a	A	G	2: 113,833,508	V810A	probably damaging	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Col5a2	C	G	1: 45,413,496	G358R	probably damaging	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Dusp13	T	A	14: 21,740,137	N47I	probably damaging	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gabrb2	T	A	11: 42,591,907	N197K	probably benign	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Tyrp1	A	G	4: 80,837,455	T154A	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfhx2	G	T	14: 55,064,557	P1990Q	probably damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
R9599:Rnf20	UTSW	4	49638751	missense	probably benign	0.00
R9661:Rnf20	UTSW	4	49654556	missense	probably damaging	0.99
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GAACTTTGCTTTGAGGCTTTCC -3'
(R):5'- TCCAGGGAGCTTCGTTAAACTG -3'

Sequencing Primer
(F):5'- TGAGGGAAAATTTGCTATTTCCAG -3'
(R):5'- GAGCTTCGTTAAACTGAGTTTTCC -3'

Posted On

2014-12-29