Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Tyrp1'

254834

Institutional Source

Beutler Lab

Gene Symbol

Tyrp1

Ensembl Gene

ENSMUSG00000005994

Gene Name

tyrosinase-related protein 1

Synonyms

Tyrp, isa, Oca3, TRP1, TRP-1

MMRRC Submission

040502-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.274) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80834123-80851719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80837455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 154 (T154A)

Ref Sequence

ENSEMBL: ENSMUSP00000117080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006151] [ENSMUST00000102831] [ENSMUST00000133655]

AlphaFold

P07147

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006151
AA Change: T154A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: T154A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Tyrosinase	182	417	1.7e-37	PFAM
transmembrane domain	479	501	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102831
AA Change: T154A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: T154A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Tyrosinase	182	417	4.9e-38	PFAM
transmembrane domain	479	501	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133655
AA Change: T154A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117080
Gene: ENSMUSG00000005994
AA Change: T154A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Tyrosinase	182	229	1.1e-7	PFAM

Meta Mutation Damage Score

0.1378

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap11a	A	G	2: 113,833,508	V810A	probably damaging	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Col5a2	C	G	1: 45,413,496	G358R	probably damaging	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Dusp13	T	A	14: 21,740,137	N47I	probably damaging	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gabrb2	T	A	11: 42,591,907	N197K	probably benign	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Rnf20	A	G	4: 49,638,769	E197G	probably benign	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfhx2	G	T	14: 55,064,557	P1990Q	probably damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Tyrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01508:Tyrp1	APN	4	80840765	missense	possibly damaging	0.95
IGL01586:Tyrp1	APN	4	80844898	missense	probably benign	0.00
IGL01620:Tyrp1	APN	4	80844802	nonsense	probably null
IGL02126:Tyrp1	APN	4	80837608	nonsense	probably null
IGL02174:Tyrp1	APN	4	80844826	nonsense	probably null
IGL02601:Tyrp1	APN	4	80840775	missense	probably null	0.00
IGL02630:Tyrp1	APN	4	80840757	missense	possibly damaging	0.95
Browncoat	UTSW	4	80835162	missense	probably damaging	1.00
butter	UTSW	4	80840806	critical splice donor site	probably null
ca-los	UTSW	4	80844868	nonsense	probably null
chi	UTSW	4	80840778	missense	probably damaging	1.00
R0011:Tyrp1	UTSW	4	80840793	missense	probably damaging	1.00
R0011:Tyrp1	UTSW	4	80840793	missense	probably damaging	1.00
R0145:Tyrp1	UTSW	4	80840778	missense	probably damaging	1.00
R1172:Tyrp1	UTSW	4	80844868	nonsense	probably null
R1173:Tyrp1	UTSW	4	80844868	nonsense	probably null
R1175:Tyrp1	UTSW	4	80844868	nonsense	probably null
R1886:Tyrp1	UTSW	4	80840806	critical splice donor site	probably null
R2099:Tyrp1	UTSW	4	80835379	missense	possibly damaging	0.69
R2273:Tyrp1	UTSW	4	80837534	missense	probably damaging	0.99
R2274:Tyrp1	UTSW	4	80837534	missense	probably damaging	0.99
R2275:Tyrp1	UTSW	4	80837534	missense	probably damaging	0.99
R2312:Tyrp1	UTSW	4	80837564	nonsense	probably null
R2427:Tyrp1	UTSW	4	80850871	missense	probably benign	0.00
R2440:Tyrp1	UTSW	4	80846606	missense	probably benign	0.41
R4343:Tyrp1	UTSW	4	80849841	missense	possibly damaging	0.92
R4512:Tyrp1	UTSW	4	80837512	missense	probably damaging	1.00
R4703:Tyrp1	UTSW	4	80840806	critical splice donor site	probably null
R4732:Tyrp1	UTSW	4	80844935	missense	possibly damaging	0.67
R4733:Tyrp1	UTSW	4	80844935	missense	possibly damaging	0.67
R4788:Tyrp1	UTSW	4	80844943	nonsense	probably null
R4834:Tyrp1	UTSW	4	80846596	nonsense	probably null
R4911:Tyrp1	UTSW	4	80850907	utr 3 prime	probably benign
R4938:Tyrp1	UTSW	4	80840646	missense	probably damaging	1.00
R5129:Tyrp1	UTSW	4	80846607	missense	probably damaging	1.00
R5154:Tyrp1	UTSW	4	80850717	missense	probably benign	0.00
R6249:Tyrp1	UTSW	4	80850772	missense	possibly damaging	0.93
R6492:Tyrp1	UTSW	4	80840781	missense	probably null	1.00
R6617:Tyrp1	UTSW	4	80846747	missense	probably benign	0.24
R6870:Tyrp1	UTSW	4	80850777	missense	probably benign	0.37
R6990:Tyrp1	UTSW	4	80835437	missense	probably damaging	1.00
R7275:Tyrp1	UTSW	4	80837584	missense	possibly damaging	0.78
R7684:Tyrp1	UTSW	4	80840625	missense	probably damaging	1.00
R7980:Tyrp1	UTSW	4	80840627	missense	probably damaging	1.00
R8001:Tyrp1	UTSW	4	80840670	missense	probably benign	0.10
R8051:Tyrp1	UTSW	4	80837660	missense	probably damaging	1.00
R8233:Tyrp1	UTSW	4	80850953	missense	unknown
R8326:Tyrp1	UTSW	4	80850684	missense	probably benign	0.06
R8831:Tyrp1	UTSW	4	80835162	missense	probably damaging	1.00
R8907:Tyrp1	UTSW	4	80837561	missense	probably damaging	1.00
R8998:Tyrp1	UTSW	4	80844857	missense	probably damaging	1.00
R8999:Tyrp1	UTSW	4	80844857	missense	probably damaging	1.00
R9732:Tyrp1	UTSW	4	80840693	missense	possibly damaging	0.52
R9751:Tyrp1	UTSW	4	80840775	missense	probably null	0.00
Z1176:Tyrp1	UTSW	4	80844889	nonsense	probably null
Z1177:Tyrp1	UTSW	4	80849817	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCATCTTGGAAATGATAACCAGC -3'
(R):5'- CCTTCGTGAGAGAAATCCACATCC -3'

Sequencing Primer
(F):5'- AGAGGCATAGCATGTTGG -3'
(R):5'- ACATCCCCAAAGCTTTCCTG -3'

Posted On

2014-12-29