Incidental Mutation 'R2915:Zfp853'
ID 254837
Institutional Source Beutler Lab
Gene Symbol Zfp853
Ensembl Gene ENSMUSG00000093910
Gene Name zinc finger protein 853
Synonyms LOC330230
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.353) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 143272793-143279378 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 143275332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000148846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180336] [ENSMUST00000212355] [ENSMUST00000212715]
AlphaFold A0A1D5RM95
Predicted Effect unknown
Transcript: ENSMUST00000180336
AA Change: E111G
SMART Domains Protein: ENSMUSP00000137494
Gene: ENSMUSG00000093910
AA Change: E111G

DomainStartEndE-ValueType
low complexity region 43 62 N/A INTRINSIC
low complexity region 80 87 N/A INTRINSIC
low complexity region 102 145 N/A INTRINSIC
coiled coil region 280 408 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
low complexity region 435 458 N/A INTRINSIC
low complexity region 488 499 N/A INTRINSIC
ZnF_C2H2 501 523 7.78e-3 SMART
ZnF_C2H2 529 551 4.87e-4 SMART
ZnF_C2H2 557 579 2.57e-3 SMART
ZnF_C2H2 585 607 2.24e-3 SMART
ZnF_C2H2 613 636 4.17e-3 SMART
low complexity region 639 651 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212355
AA Change: E111G
Predicted Effect unknown
Transcript: ENSMUST00000212715
AA Change: E96G
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Dusp13b T A 14: 21,790,205 (GRCm39) N47I probably damaging Het
Elmo2 A G 2: 165,139,573 (GRCm39) probably benign Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gabrb2 T A 11: 42,482,734 (GRCm39) N197K probably benign Het
Gdnf T A 15: 7,845,130 (GRCm39) V41E possibly damaging Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Ice2 A G 9: 69,318,122 (GRCm39) D241G probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or5t9 T C 2: 86,659,570 (GRCm39) I158T probably benign Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pax1 A G 2: 147,210,348 (GRCm39) Y361C probably damaging Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Zfp853
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1656:Zfp853 UTSW 5 143,274,840 (GRCm39) splice site probably benign
R2072:Zfp853 UTSW 5 143,275,137 (GRCm39) missense unknown
R4862:Zfp853 UTSW 5 143,275,416 (GRCm39) missense unknown
R4869:Zfp853 UTSW 5 143,274,048 (GRCm39) missense probably damaging 0.99
R4945:Zfp853 UTSW 5 143,274,584 (GRCm39) missense unknown
R5139:Zfp853 UTSW 5 143,274,570 (GRCm39) missense unknown
R5335:Zfp853 UTSW 5 143,274,318 (GRCm39) missense unknown
R5426:Zfp853 UTSW 5 143,274,624 (GRCm39) missense unknown
R5844:Zfp853 UTSW 5 143,274,424 (GRCm39) missense unknown
R5845:Zfp853 UTSW 5 143,274,424 (GRCm39) missense unknown
R5847:Zfp853 UTSW 5 143,274,424 (GRCm39) missense unknown
R6039:Zfp853 UTSW 5 143,274,529 (GRCm39) nonsense probably null
R6039:Zfp853 UTSW 5 143,274,529 (GRCm39) nonsense probably null
R7124:Zfp853 UTSW 5 143,275,362 (GRCm39) missense unknown
R7283:Zfp853 UTSW 5 143,273,493 (GRCm39) missense unknown
R7323:Zfp853 UTSW 5 143,275,110 (GRCm39) missense unknown
R8026:Zfp853 UTSW 5 143,274,280 (GRCm39) missense unknown
R8121:Zfp853 UTSW 5 143,274,018 (GRCm39) missense probably damaging 0.99
R8290:Zfp853 UTSW 5 143,274,826 (GRCm39) nonsense probably null
R8347:Zfp853 UTSW 5 143,274,702 (GRCm39) missense unknown
R9017:Zfp853 UTSW 5 143,274,243 (GRCm39) missense unknown
R9110:Zfp853 UTSW 5 143,275,320 (GRCm39) missense unknown
R9123:Zfp853 UTSW 5 143,274,496 (GRCm39) nonsense probably null
R9560:Zfp853 UTSW 5 143,275,080 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTGCATCATCTGGTGCTG -3'
(R):5'- CCTGCCATTTCCACTACAGGTG -3'

Sequencing Primer
(F):5'- AAATGTTGCTCTTGTCCAAGTC -3'
(R):5'- CACTACAGGTGGCAGTGGTG -3'
Posted On 2014-12-29