Incidental Mutation 'R2915:Vrk3'
ID 254846
Institutional Source Beutler Lab
Gene Symbol Vrk3
Ensembl Gene ENSMUSG00000002205
Gene Name vaccinia related kinase 3
Synonyms
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 44748413-44777515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44775442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 427 (T427M)
Ref Sequence ENSEMBL: ENSMUSP00000002275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002275] [ENSMUST00000147952]
AlphaFold Q8K3G5
Predicted Effect probably benign
Transcript: ENSMUST00000002275
AA Change: T427M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000002275
Gene: ENSMUSG00000002205
AA Change: T427M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 212 432 3.2e-8 PFAM
Pfam:Pkinase 218 432 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147952
SMART Domains Protein: ENSMUSP00000130331
Gene: ENSMUSG00000002205

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 1.1e-11 PFAM
Pfam:zinc_ribbon_2 4 26 2.9e-10 PFAM
PDB:2JII|B 117 162 1e-8 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. In both human and mouse, this gene has substitutions at several residues within the ATP binding motifs that in other kinases have been shown to be required for catalysis. In vitro assays indicate the protein lacks phosphorylation activity. The protein, however, likely retains its substrate binding capability. This gene is widely expressed in human tissues and its protein localizes to the nucleus. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired social behavior, decreased fear and anxiety relate behavior, impaired spatial memory, and abnormal hippocampal dendritic spine and synapse morphologies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Vrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Vrk3 APN 7 44769647 missense probably damaging 1.00
IGL01540:Vrk3 APN 7 44767144 missense probably damaging 1.00
IGL02682:Vrk3 APN 7 44753820 missense probably benign 0.19
R0462:Vrk3 UTSW 7 44764200 missense possibly damaging 0.77
R0831:Vrk3 UTSW 7 44764803 missense probably damaging 1.00
R1760:Vrk3 UTSW 7 44768471 missense probably damaging 0.98
R2212:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R2289:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3027:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3028:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3416:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3417:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3613:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3877:Vrk3 UTSW 7 44763036 splice site probably null
R4357:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4359:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4379:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4381:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4439:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4441:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4773:Vrk3 UTSW 7 44775476 missense probably benign
R5222:Vrk3 UTSW 7 44759796 missense possibly damaging 0.67
R5808:Vrk3 UTSW 7 44759874 missense probably damaging 0.96
R6180:Vrk3 UTSW 7 44769611 missense possibly damaging 0.50
R7007:Vrk3 UTSW 7 44757763 missense probably damaging 0.97
R7058:Vrk3 UTSW 7 44768466 missense probably damaging 0.98
R7425:Vrk3 UTSW 7 44770924 critical splice donor site probably null
R7995:Vrk3 UTSW 7 44764161 missense probably damaging 1.00
R8804:Vrk3 UTSW 7 44757846 nonsense probably null
R9123:Vrk3 UTSW 7 44757830 missense possibly damaging 0.94
R9330:Vrk3 UTSW 7 44775486 missense probably damaging 0.98
R9681:Vrk3 UTSW 7 44753932 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGATGCTTCCCACACCGAC -3'
(R):5'- AGATCACCCAGCTGAATTCC -3'

Sequencing Primer
(F):5'- CAGCAGATACAAGAACTCCCAGTG -3'
(R):5'- CAGCTCTTGAATTGACTTCAGG -3'
Posted On 2014-12-29