Incidental Mutation 'R2915:B3gnt6'
ID 254848
Institutional Source Beutler Lab
Gene Symbol B3gnt6
Ensembl Gene ENSMUSG00000074004
Gene Name UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Synonyms
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 98192417-98199481 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98193593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 387 (N387D)
Ref Sequence ENSEMBL: ENSMUSP00000095879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098278]
AlphaFold Q3USF0
Predicted Effect probably benign
Transcript: ENSMUST00000098278
AA Change: N387D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095879
Gene: ENSMUSG00000074004
AA Change: N387D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Galactosyl_T 126 322 1.1e-48 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a beta-1,3-N-acetylglucosaminyltransferase that adds an N-acetylglucosamine moiety to N-acetylgalactosamine-modified serine or threonine. The encoded enzyme is responsible for creating the core 3 structure of O-glycans, which are important components of mucin-type glycoproteins. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozgous for a knock-out allele exhibit increased permeability of the intestinal barrier, increased susceptibility to DSS-induced colitis and accelerated colorectal tumorigenesis in mice treated with AOM and DSS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in B3gnt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:B3gnt6 APN 7 98194523 missense probably damaging 1.00
IGL02104:B3gnt6 APN 7 98194101 missense probably damaging 1.00
R0631:B3gnt6 UTSW 7 98193692 missense probably benign 0.02
R0849:B3gnt6 UTSW 7 98194743 missense probably benign
R1015:B3gnt6 UTSW 7 98194595 missense probably benign 0.00
R2034:B3gnt6 UTSW 7 98194018 missense possibly damaging 0.92
R8984:B3gnt6 UTSW 7 98193614 missense probably benign 0.00
R8996:B3gnt6 UTSW 7 98193592 missense probably benign
R9100:B3gnt6 UTSW 7 98194751 start codon destroyed not run
R9549:B3gnt6 UTSW 7 98194449 missense possibly damaging 0.81
Z1176:B3gnt6 UTSW 7 98193889 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATGAACAGATAGATAGCCCCAGC -3'
(R):5'- ATCGACGATGCCTACATGGG -3'

Sequencing Primer
(F):5'- TAGATAGCCCCAGCCCAGAGG -3'
(R):5'- ATGTGTCTGCAGCAGGC -3'
Posted On 2014-12-29