Incidental Mutation 'R0318:Veph1'
ID25485
Institutional Source Beutler Lab
Gene Symbol Veph1
Ensembl Gene ENSMUSG00000027831
Gene Nameventricular zone expressed PH domain-containing 1
SynonymsVeph, 2810471M23Rik
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0318 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location66053558-66296837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66057259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 783 (S783Y)
Ref Sequence ENSEMBL: ENSMUSP00000029419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029419]
Predicted Effect probably damaging
Transcript: ENSMUST00000029419
AA Change: S783Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029419
Gene: ENSMUSG00000027831
AA Change: S783Y

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Blast:PH 586 626 1e-5 BLAST
PH 717 821 1.44e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107837
SMART Domains Protein: ENSMUSP00000103468
Gene: ENSMUSG00000027831

DomainStartEndE-ValueType
Blast:PH 6 46 6e-6 BLAST
PH 137 241 6.5e-17 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
Blk A G 14: 63,374,197 Y430H probably damaging Het
C3 C T 17: 57,224,709 V272M probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Chaf1a C T 17: 56,062,227 T486I possibly damaging Het
Colec12 A G 18: 9,848,446 N208S possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Mapkapk2 A G 1: 131,097,335 V64A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr995 C A 2: 85,438,237 R307M possibly damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Smg9 T C 7: 24,420,888 F429S possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in Veph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Veph1 APN 3 66255010 missense probably damaging 1.00
IGL01539:Veph1 APN 3 66158075 missense probably benign 0.00
IGL01746:Veph1 APN 3 66158087 missense probably benign
IGL02055:Veph1 APN 3 66205627 missense possibly damaging 0.94
IGL02504:Veph1 APN 3 66172130 missense probably damaging 1.00
IGL02610:Veph1 APN 3 66172167 missense probably damaging 1.00
IGL02647:Veph1 APN 3 66159448 splice site probably benign
IGL03279:Veph1 APN 3 66255022 missense probably damaging 1.00
R0317:Veph1 UTSW 3 66171975 missense probably benign
R0418:Veph1 UTSW 3 66255028 nonsense probably null
R1913:Veph1 UTSW 3 66244555 missense probably damaging 1.00
R2081:Veph1 UTSW 3 66061102 missense probably damaging 1.00
R2116:Veph1 UTSW 3 66057189 missense probably benign 0.06
R3622:Veph1 UTSW 3 66215437 missense probably benign 0.01
R3623:Veph1 UTSW 3 66215437 missense probably benign 0.01
R3624:Veph1 UTSW 3 66215437 missense probably benign 0.01
R3829:Veph1 UTSW 3 66159327 missense possibly damaging 0.92
R3862:Veph1 UTSW 3 66254892 missense probably damaging 1.00
R3974:Veph1 UTSW 3 66158227 missense probably benign
R4209:Veph1 UTSW 3 66244546 missense probably damaging 1.00
R4361:Veph1 UTSW 3 66159316 missense probably benign 0.00
R4416:Veph1 UTSW 3 66061185 missense probably damaging 0.99
R5478:Veph1 UTSW 3 66255022 missense probably damaging 1.00
R6218:Veph1 UTSW 3 66255060 missense probably damaging 1.00
R6399:Veph1 UTSW 3 66125891 missense probably benign 0.03
R6655:Veph1 UTSW 3 66205613 missense possibly damaging 0.50
R6867:Veph1 UTSW 3 66255037 missense probably damaging 1.00
R6877:Veph1 UTSW 3 66255084 missense probably damaging 1.00
R7257:Veph1 UTSW 3 66158282 missense probably benign 0.00
R7723:Veph1 UTSW 3 66205672 missense possibly damaging 0.95
X0025:Veph1 UTSW 3 66244496 missense probably benign
Z1176:Veph1 UTSW 3 66244488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGAGGTTTACTGAGAACCCTG -3'
(R):5'- ATACCATGTGAAAGGACCTGGCCC -3'

Sequencing Primer
(F):5'- GTTGACACTGGCAATGCTTATC -3'
(R):5'- AAAGGACCTGGCCCTCTTG -3'
Posted On2013-04-16