Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Sgk1'

254853

Institutional Source

Beutler Lab

Gene Symbol

Sgk1

Ensembl Gene

ENSMUSG00000019970

Gene Name

serum/glucocorticoid regulated kinase 1

Synonyms

Sgk, Sgk1

MMRRC Submission

040502-MU

Accession Numbers

Ncbi RefSeq: NM_001161845.2, NM_001161847.2, NM_001161848.2, NM_001161849.2, NM_001161850.2, NM_011361.3; MGI:1340062

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21882184-21999903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21996601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 171 (R171W)

Ref Sequence

ENSEMBL: ENSMUSP00000128873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020145] [ENSMUST00000092673] [ENSMUST00000100036] [ENSMUST00000120509] [ENSMUST00000124350] [ENSMUST00000142174] [ENSMUST00000150089] [ENSMUST00000164659]

AlphaFold

Q9WVC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020145
AA Change: R198W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020145
Gene: ENSMUSG00000019970
AA Change: R198W

Domain	Start	End	E-Value	Type
Blast:S_TKc	36	72	4e-10	BLAST
low complexity region	73	80	N/A	INTRINSIC
S_TKc	98	355	6.15e-106	SMART
S_TK_X	356	425	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000092673
AA Change: R212W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090343
Gene: ENSMUSG00000019970
AA Change: R212W

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
Blast:S_TKc	50	86	5e-10	BLAST
low complexity region	87	94	N/A	INTRINSIC
S_TKc	112	369	6.15e-106	SMART
S_TK_X	370	439	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100036
AA Change: R184W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097614
Gene: ENSMUSG00000019970
AA Change: R184W

Domain	Start	End	E-Value	Type
Blast:S_TKc	22	58	5e-10	BLAST
low complexity region	59	66	N/A	INTRINSIC
S_TKc	84	341	6.15e-106	SMART
S_TK_X	342	411	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120509
AA Change: R291W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970
AA Change: R291W

Domain	Start	End	E-Value	Type
Blast:S_TKc	129	165	1e-9	BLAST
low complexity region	166	173	N/A	INTRINSIC
S_TKc	191	448	6.15e-106	SMART
S_TK_X	449	518	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124350
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114691
Gene: ENSMUSG00000019970
AA Change: R171W

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	2e-12	BLAST
low complexity region	46	53	N/A	INTRINSIC
Pfam:Pkinase	71	266	3.2e-62	PFAM
Pfam:Pkinase_Tyr	71	266	4.4e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141218

Predicted Effect

probably benign
Transcript: ENSMUST00000142174

SMART Domains

Protein: ENSMUSP00000120882
Gene: ENSMUSG00000019970

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	3e-14	BLAST
PDB:3HDN\|A	33	82	7e-18	PDB
SCOP:d1koba_	43	82	4e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150089

SMART Domains

Protein: ENSMUSP00000115073
Gene: ENSMUSG00000019970

Domain	Start	End	E-Value	Type
Blast:S_TKc	22	58	4e-14	BLAST
PDB:3HDN\|A	46	89	3e-13	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000164659
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128873
Gene: ENSMUSG00000019970
AA Change: R171W

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	5e-10	BLAST
low complexity region	46	53	N/A	INTRINSIC
S_TKc	71	328	6.15e-106	SMART
S_TK_X	329	398	2.51e-19	SMART

Meta Mutation Damage Score

0.7105

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

Strain: 3846797; 2445418
FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]

Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap11a	A	G	2: 113,833,508	V810A	probably damaging	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Col5a2	C	G	1: 45,413,496	G358R	probably damaging	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Dusp13	T	A	14: 21,740,137	N47I	probably damaging	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gabrb2	T	A	11: 42,591,907	N197K	probably benign	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Rnf20	A	G	4: 49,638,769	E197G	probably benign	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Tyrp1	A	G	4: 80,837,455	T154A	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfhx2	G	T	14: 55,064,557	P1990Q	probably damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Sgk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02318:Sgk1	APN	10	21995541	missense	probably damaging	1.00
IGL02670:Sgk1	APN	10	21928546	missense	probably benign
IGL03220:Sgk1	APN	10	21997391	missense	probably null	1.00
R0010:Sgk1	UTSW	10	21997438	critical splice donor site	probably null
R0010:Sgk1	UTSW	10	21997438	critical splice donor site	probably null
R0467:Sgk1	UTSW	10	21996358	splice site	probably benign
R0479:Sgk1	UTSW	10	21996310	missense	probably benign	0.00
R0650:Sgk1	UTSW	10	21882657	missense	probably damaging	0.98
R0652:Sgk1	UTSW	10	21882657	missense	probably damaging	0.98
R0688:Sgk1	UTSW	10	21998160	missense	probably benign
R0990:Sgk1	UTSW	10	21997086	missense	probably damaging	1.00
R1769:Sgk1	UTSW	10	21997108	splice site	probably benign
R2009:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R2218:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R2314:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R2909:Sgk1	UTSW	10	21994816	missense	probably benign
R3176:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3177:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3276:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3277:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3802:Sgk1	UTSW	10	21997412	missense	probably damaging	1.00
R5974:Sgk1	UTSW	10	21996249	missense	probably damaging	1.00
R6943:Sgk1	UTSW	10	21882694	missense	probably damaging	0.99
R7360:Sgk1	UTSW	10	21994073	missense	probably benign	0.01
R7425:Sgk1	UTSW	10	21994110	missense	probably damaging	0.97
R7665:Sgk1	UTSW	10	21996662	missense	probably damaging	1.00
R7973:Sgk1	UTSW	10	21994155	missense	probably benign	0.01
R8252:Sgk1	UTSW	10	21997399	missense	probably damaging	1.00
R8855:Sgk1	UTSW	10	21995827	missense	probably benign	0.12
R9199:Sgk1	UTSW	10	21882659	missense	probably damaging	0.99
R9492:Sgk1	UTSW	10	21998197	missense	probably damaging	0.97
R9670:Sgk1	UTSW	10	21992391	frame shift	probably null
R9683:Sgk1	UTSW	10	21992391	frame shift	probably null
R9723:Sgk1	UTSW	10	21996340	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCCAGACCGCTGACAAGC -3'
(R):5'- TAGAGGTGACCAAAGTGCAC -3'

Sequencing Primer
(F):5'- CCTGGACTACATTAATGGTGGAG -3'
(R):5'- GGTGACCAAAGTGCACATAATATCTC -3'

Posted On

2014-12-29