Incidental Mutation 'R2915:Sgk1'
ID 254853
Institutional Source Beutler Lab
Gene Symbol Sgk1
Ensembl Gene ENSMUSG00000019970
Gene Name serum/glucocorticoid regulated kinase 1
Synonyms Sgk
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 21758083-21875802 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21872500 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 171 (R171W)
Ref Sequence ENSEMBL: ENSMUSP00000128873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020145] [ENSMUST00000092673] [ENSMUST00000100036] [ENSMUST00000120509] [ENSMUST00000124350] [ENSMUST00000142174] [ENSMUST00000164659] [ENSMUST00000150089]
AlphaFold Q9WVC6
Predicted Effect probably damaging
Transcript: ENSMUST00000020145
AA Change: R198W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020145
Gene: ENSMUSG00000019970
AA Change: R198W

DomainStartEndE-ValueType
Blast:S_TKc 36 72 4e-10 BLAST
low complexity region 73 80 N/A INTRINSIC
S_TKc 98 355 6.15e-106 SMART
S_TK_X 356 425 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092673
AA Change: R212W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090343
Gene: ENSMUSG00000019970
AA Change: R212W

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Blast:S_TKc 50 86 5e-10 BLAST
low complexity region 87 94 N/A INTRINSIC
S_TKc 112 369 6.15e-106 SMART
S_TK_X 370 439 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100036
AA Change: R184W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097614
Gene: ENSMUSG00000019970
AA Change: R184W

DomainStartEndE-ValueType
Blast:S_TKc 22 58 5e-10 BLAST
low complexity region 59 66 N/A INTRINSIC
S_TKc 84 341 6.15e-106 SMART
S_TK_X 342 411 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120509
AA Change: R291W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970
AA Change: R291W

DomainStartEndE-ValueType
Blast:S_TKc 129 165 1e-9 BLAST
low complexity region 166 173 N/A INTRINSIC
S_TKc 191 448 6.15e-106 SMART
S_TK_X 449 518 2.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124350
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114691
Gene: ENSMUSG00000019970
AA Change: R171W

DomainStartEndE-ValueType
Blast:S_TKc 9 45 2e-12 BLAST
low complexity region 46 53 N/A INTRINSIC
Pfam:Pkinase 71 266 3.2e-62 PFAM
Pfam:Pkinase_Tyr 71 266 4.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141218
Predicted Effect probably benign
Transcript: ENSMUST00000142174
SMART Domains Protein: ENSMUSP00000120882
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 9 45 3e-14 BLAST
PDB:3HDN|A 33 82 7e-18 PDB
SCOP:d1koba_ 43 82 4e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164659
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128873
Gene: ENSMUSG00000019970
AA Change: R171W

DomainStartEndE-ValueType
Blast:S_TKc 9 45 5e-10 BLAST
low complexity region 46 53 N/A INTRINSIC
S_TKc 71 328 6.15e-106 SMART
S_TK_X 329 398 2.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150089
SMART Domains Protein: ENSMUSP00000115073
Gene: ENSMUSG00000019970

DomainStartEndE-ValueType
Blast:S_TKc 22 58 4e-14 BLAST
PDB:3HDN|A 46 89 3e-13 PDB
Meta Mutation Damage Score 0.7105 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Dusp13b T A 14: 21,790,205 (GRCm39) N47I probably damaging Het
Elmo2 A G 2: 165,139,573 (GRCm39) probably benign Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gabrb2 T A 11: 42,482,734 (GRCm39) N197K probably benign Het
Gdnf T A 15: 7,845,130 (GRCm39) V41E possibly damaging Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Ice2 A G 9: 69,318,122 (GRCm39) D241G probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or5t9 T C 2: 86,659,570 (GRCm39) I158T probably benign Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pax1 A G 2: 147,210,348 (GRCm39) Y361C probably damaging Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zfp853 T C 5: 143,275,332 (GRCm39) E96G unknown Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Sgk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Sgk1 APN 10 21,871,440 (GRCm39) missense probably damaging 1.00
IGL02670:Sgk1 APN 10 21,804,445 (GRCm39) missense probably benign
IGL03220:Sgk1 APN 10 21,873,290 (GRCm39) missense probably null 1.00
R0010:Sgk1 UTSW 10 21,873,337 (GRCm39) critical splice donor site probably null
R0010:Sgk1 UTSW 10 21,873,337 (GRCm39) critical splice donor site probably null
R0467:Sgk1 UTSW 10 21,872,257 (GRCm39) splice site probably benign
R0479:Sgk1 UTSW 10 21,872,209 (GRCm39) missense probably benign 0.00
R0650:Sgk1 UTSW 10 21,758,556 (GRCm39) missense probably damaging 0.98
R0652:Sgk1 UTSW 10 21,758,556 (GRCm39) missense probably damaging 0.98
R0688:Sgk1 UTSW 10 21,874,059 (GRCm39) missense probably benign
R0990:Sgk1 UTSW 10 21,872,985 (GRCm39) missense probably damaging 1.00
R1769:Sgk1 UTSW 10 21,873,007 (GRCm39) splice site probably benign
R2009:Sgk1 UTSW 10 21,872,500 (GRCm39) missense probably damaging 1.00
R2218:Sgk1 UTSW 10 21,872,500 (GRCm39) missense probably damaging 1.00
R2314:Sgk1 UTSW 10 21,872,500 (GRCm39) missense probably damaging 1.00
R2909:Sgk1 UTSW 10 21,870,715 (GRCm39) missense probably benign
R3176:Sgk1 UTSW 10 21,872,500 (GRCm39) missense probably damaging 1.00
R3177:Sgk1 UTSW 10 21,872,500 (GRCm39) missense probably damaging 1.00
R3276:Sgk1 UTSW 10 21,872,500 (GRCm39) missense probably damaging 1.00
R3277:Sgk1 UTSW 10 21,872,500 (GRCm39) missense probably damaging 1.00
R3802:Sgk1 UTSW 10 21,873,311 (GRCm39) missense probably damaging 1.00
R5974:Sgk1 UTSW 10 21,872,148 (GRCm39) missense probably damaging 1.00
R6943:Sgk1 UTSW 10 21,758,593 (GRCm39) missense probably damaging 0.99
R7360:Sgk1 UTSW 10 21,869,972 (GRCm39) missense probably benign 0.01
R7425:Sgk1 UTSW 10 21,870,009 (GRCm39) missense probably damaging 0.97
R7665:Sgk1 UTSW 10 21,872,561 (GRCm39) missense probably damaging 1.00
R7973:Sgk1 UTSW 10 21,870,054 (GRCm39) missense probably benign 0.01
R8252:Sgk1 UTSW 10 21,873,298 (GRCm39) missense probably damaging 1.00
R8855:Sgk1 UTSW 10 21,871,726 (GRCm39) missense probably benign 0.12
R9199:Sgk1 UTSW 10 21,758,558 (GRCm39) missense probably damaging 0.99
R9492:Sgk1 UTSW 10 21,874,096 (GRCm39) missense probably damaging 0.97
R9670:Sgk1 UTSW 10 21,868,290 (GRCm39) frame shift probably null
R9683:Sgk1 UTSW 10 21,868,290 (GRCm39) frame shift probably null
R9723:Sgk1 UTSW 10 21,872,239 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCAGACCGCTGACAAGC -3'
(R):5'- TAGAGGTGACCAAAGTGCAC -3'

Sequencing Primer
(F):5'- CCTGGACTACATTAATGGTGGAG -3'
(R):5'- GGTGACCAAAGTGCACATAATATCTC -3'
Posted On 2014-12-29