Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Gabrb2'

254855

Institutional Source

Beutler Lab

Gene Symbol

Gabrb2

Ensembl Gene

ENSMUSG00000007653

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit beta 2

Synonyms

C030002O17Rik, C030021G16Rik, Gabrb-2

MMRRC Submission

040502-MU

Accession Numbers

Genbank: NM_008070

Essential gene?

Possibly essential (E-score: 0.512) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42419757-42629028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42591907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 197 (N197K)

Ref Sequence

ENSEMBL: ENSMUSP00000141868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]

AlphaFold

P63137

Predicted Effect

probably benign
Transcript: ENSMUST00000007797
AA Change: N197K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: N197K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	36	242	8.7e-52	PFAM
Pfam:Neur_chan_memb	249	469	7.5e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000192403
AA Change: N197K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: N197K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	36	242	1.1e-54	PFAM
Pfam:Neur_chan_memb	249	507	6.6e-55	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap11a	A	G	2: 113,833,508	V810A	probably damaging	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Col5a2	C	G	1: 45,413,496	G358R	probably damaging	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Dusp13	T	A	14: 21,740,137	N47I	probably damaging	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Rnf20	A	G	4: 49,638,769	E197G	probably benign	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Tyrp1	A	G	4: 80,837,455	T154A	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfhx2	G	T	14: 55,064,557	P1990Q	probably damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Gabrb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02275:Gabrb2	APN	11	42591894	missense	probably benign	0.00
IGL02666:Gabrb2	APN	11	42529495	critical splice donor site	probably null
IGL02983:Gabrb2	APN	11	42421400	missense	probably benign	0.00
IGL03357:Gabrb2	APN	11	42591944	missense	probably damaging	1.00
H2330:Gabrb2	UTSW	11	42421431	splice site	probably benign
R0049:Gabrb2	UTSW	11	42593847	missense	probably damaging	1.00
R0049:Gabrb2	UTSW	11	42593847	missense	probably damaging	1.00
R0100:Gabrb2	UTSW	11	42487314	missense	probably damaging	1.00
R1423:Gabrb2	UTSW	11	42529471	missense	probably damaging	1.00
R1526:Gabrb2	UTSW	11	42591888	missense	possibly damaging	0.83
R1856:Gabrb2	UTSW	11	42626713	missense	probably benign	0.01
R1898:Gabrb2	UTSW	11	42593832	missense	possibly damaging	0.51
R2184:Gabrb2	UTSW	11	42421428	critical splice donor site	probably null
R2371:Gabrb2	UTSW	11	42591864	missense	probably damaging	1.00
R2993:Gabrb2	UTSW	11	42597649	missense	probably damaging	0.99
R3951:Gabrb2	UTSW	11	42626881	missense	probably damaging	1.00
R4167:Gabrb2	UTSW	11	42421328	unclassified	probably benign
R4168:Gabrb2	UTSW	11	42421328	unclassified	probably benign
R4497:Gabrb2	UTSW	11	42597694	missense	probably benign	0.05
R4572:Gabrb2	UTSW	11	42593917	missense	possibly damaging	0.46
R4784:Gabrb2	UTSW	11	42597642	missense	probably damaging	1.00
R4792:Gabrb2	UTSW	11	42529503	splice site	probably benign
R5345:Gabrb2	UTSW	11	42626809	missense	possibly damaging	0.54
R5346:Gabrb2	UTSW	11	42421389	missense	probably benign
R5575:Gabrb2	UTSW	11	42529538	intron	probably benign
R5701:Gabrb2	UTSW	11	42487374	missense	probably damaging	1.00
R5801:Gabrb2	UTSW	11	42421389	missense	probably benign	0.00
R5965:Gabrb2	UTSW	11	42626869	missense	probably damaging	1.00
R6738:Gabrb2	UTSW	11	42593931	missense	possibly damaging	0.95
R6930:Gabrb2	UTSW	11	42597613	missense	probably damaging	1.00
R7011:Gabrb2	UTSW	11	42626661	missense	possibly damaging	0.76
R7045:Gabrb2	UTSW	11	42593931	missense	probably damaging	1.00
R7615:Gabrb2	UTSW	11	42626742	missense	probably benign	0.06
R7653:Gabrb2	UTSW	11	42487212	missense	probably damaging	1.00
R7866:Gabrb2	UTSW	11	42487223	nonsense	probably null
R8094:Gabrb2	UTSW	11	42597543	missense	probably damaging	0.98
R8402:Gabrb2	UTSW	11	42487304	missense	probably damaging	1.00
R8488:Gabrb2	UTSW	11	42626664	missense	possibly damaging	0.85
R8851:Gabrb2	UTSW	11	42421359	missense	probably benign
R9123:Gabrb2	UTSW	11	42591866	missense	probably damaging	0.97
R9125:Gabrb2	UTSW	11	42591866	missense	probably damaging	0.97
R9186:Gabrb2	UTSW	11	42487373	missense	possibly damaging	0.51
R9672:Gabrb2	UTSW	11	42421380	missense	probably benign	0.00
R9746:Gabrb2	UTSW	11	42626609	missense	probably benign	0.00
RF008:Gabrb2	UTSW	11	42626878	missense	probably damaging	1.00
X0020:Gabrb2	UTSW	11	42422646	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- GCTTAGACTGATTGCTACTTCGC -3'
(R):5'- GCATAGCTTCTACTCTGCTGG -3'

Sequencing Primer
(F):5'- AGACTGATTGCTACTTCGCACATC -3'
(R):5'- TGGTTCCTAGGATACAGAGCCAC -3'

Posted On

2014-12-29