Incidental Mutation 'R2915:Gabrb2'
ID 254855
Institutional Source Beutler Lab
Gene Symbol Gabrb2
Ensembl Gene ENSMUSG00000007653
Gene Name gamma-aminobutyric acid type A receptor subunit beta 2
Synonyms C030021G16Rik, Gabrb-2, C030002O17Rik
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.473) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 42310584-42519855 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42482734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 197 (N197K)
Ref Sequence ENSEMBL: ENSMUSP00000141868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]
AlphaFold P63137
Predicted Effect probably benign
Transcript: ENSMUST00000007797
AA Change: N197K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: N197K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 8.7e-52 PFAM
Pfam:Neur_chan_memb 249 469 7.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192403
AA Change: N197K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: N197K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 1.1e-54 PFAM
Pfam:Neur_chan_memb 249 507 6.6e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Dusp13b T A 14: 21,790,205 (GRCm39) N47I probably damaging Het
Elmo2 A G 2: 165,139,573 (GRCm39) probably benign Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gdnf T A 15: 7,845,130 (GRCm39) V41E possibly damaging Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Ice2 A G 9: 69,318,122 (GRCm39) D241G probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or5t9 T C 2: 86,659,570 (GRCm39) I158T probably benign Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pax1 A G 2: 147,210,348 (GRCm39) Y361C probably damaging Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zfp853 T C 5: 143,275,332 (GRCm39) E96G unknown Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Gabrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:Gabrb2 APN 11 42,482,721 (GRCm39) missense probably benign 0.00
IGL02666:Gabrb2 APN 11 42,420,322 (GRCm39) critical splice donor site probably null
IGL02983:Gabrb2 APN 11 42,312,227 (GRCm39) missense probably benign 0.00
IGL03357:Gabrb2 APN 11 42,482,771 (GRCm39) missense probably damaging 1.00
H2330:Gabrb2 UTSW 11 42,312,258 (GRCm39) splice site probably benign
R0049:Gabrb2 UTSW 11 42,484,674 (GRCm39) missense probably damaging 1.00
R0049:Gabrb2 UTSW 11 42,484,674 (GRCm39) missense probably damaging 1.00
R0100:Gabrb2 UTSW 11 42,378,141 (GRCm39) missense probably damaging 1.00
R1423:Gabrb2 UTSW 11 42,420,298 (GRCm39) missense probably damaging 1.00
R1526:Gabrb2 UTSW 11 42,482,715 (GRCm39) missense possibly damaging 0.83
R1856:Gabrb2 UTSW 11 42,517,540 (GRCm39) missense probably benign 0.01
R1898:Gabrb2 UTSW 11 42,484,659 (GRCm39) missense possibly damaging 0.51
R2184:Gabrb2 UTSW 11 42,312,255 (GRCm39) critical splice donor site probably null
R2371:Gabrb2 UTSW 11 42,482,691 (GRCm39) missense probably damaging 1.00
R2993:Gabrb2 UTSW 11 42,488,476 (GRCm39) missense probably damaging 0.99
R3951:Gabrb2 UTSW 11 42,517,708 (GRCm39) missense probably damaging 1.00
R4167:Gabrb2 UTSW 11 42,312,155 (GRCm39) unclassified probably benign
R4168:Gabrb2 UTSW 11 42,312,155 (GRCm39) unclassified probably benign
R4497:Gabrb2 UTSW 11 42,488,521 (GRCm39) missense probably benign 0.05
R4572:Gabrb2 UTSW 11 42,484,744 (GRCm39) missense possibly damaging 0.46
R4784:Gabrb2 UTSW 11 42,488,469 (GRCm39) missense probably damaging 1.00
R4792:Gabrb2 UTSW 11 42,420,330 (GRCm39) splice site probably benign
R5345:Gabrb2 UTSW 11 42,517,636 (GRCm39) missense possibly damaging 0.54
R5346:Gabrb2 UTSW 11 42,312,216 (GRCm39) missense probably benign
R5575:Gabrb2 UTSW 11 42,420,365 (GRCm39) intron probably benign
R5701:Gabrb2 UTSW 11 42,378,201 (GRCm39) missense probably damaging 1.00
R5801:Gabrb2 UTSW 11 42,312,216 (GRCm39) missense probably benign 0.00
R5965:Gabrb2 UTSW 11 42,517,696 (GRCm39) missense probably damaging 1.00
R6738:Gabrb2 UTSW 11 42,484,758 (GRCm39) missense possibly damaging 0.95
R6930:Gabrb2 UTSW 11 42,488,440 (GRCm39) missense probably damaging 1.00
R7011:Gabrb2 UTSW 11 42,517,488 (GRCm39) missense possibly damaging 0.76
R7045:Gabrb2 UTSW 11 42,484,758 (GRCm39) missense probably damaging 1.00
R7615:Gabrb2 UTSW 11 42,517,569 (GRCm39) missense probably benign 0.06
R7653:Gabrb2 UTSW 11 42,378,039 (GRCm39) missense probably damaging 1.00
R7866:Gabrb2 UTSW 11 42,378,050 (GRCm39) nonsense probably null
R8094:Gabrb2 UTSW 11 42,488,370 (GRCm39) missense probably damaging 0.98
R8402:Gabrb2 UTSW 11 42,378,131 (GRCm39) missense probably damaging 1.00
R8488:Gabrb2 UTSW 11 42,517,491 (GRCm39) missense possibly damaging 0.85
R8851:Gabrb2 UTSW 11 42,312,186 (GRCm39) missense probably benign
R9123:Gabrb2 UTSW 11 42,482,693 (GRCm39) missense probably damaging 0.97
R9125:Gabrb2 UTSW 11 42,482,693 (GRCm39) missense probably damaging 0.97
R9186:Gabrb2 UTSW 11 42,378,200 (GRCm39) missense possibly damaging 0.51
R9672:Gabrb2 UTSW 11 42,312,207 (GRCm39) missense probably benign 0.00
R9746:Gabrb2 UTSW 11 42,517,436 (GRCm39) missense probably benign 0.00
RF008:Gabrb2 UTSW 11 42,517,705 (GRCm39) missense probably damaging 1.00
X0020:Gabrb2 UTSW 11 42,313,473 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCTTAGACTGATTGCTACTTCGC -3'
(R):5'- GCATAGCTTCTACTCTGCTGG -3'

Sequencing Primer
(F):5'- AGACTGATTGCTACTTCGCACATC -3'
(R):5'- TGGTTCCTAGGATACAGAGCCAC -3'
Posted On 2014-12-29