Incidental Mutation 'R2915:Tdrd9'
ID254859
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Nametudor domain containing 9
Synonyms
MMRRC Submission 040502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R2915 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111971559-112068854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112040461 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 920 (D920N)
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
Predicted Effect probably damaging
Transcript: ENSMUST00000079009
AA Change: D920N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: D920N

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193586
Meta Mutation Damage Score 0.3443 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 112007580 intron probably benign
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4237:Tdrd9 UTSW 12 112067625 nonsense probably null
R4482:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5301:Tdrd9 UTSW 12 112036529 critical splice donor site probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 synonymous probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111985042 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CTAGACCCCTGAAAGCCTTC -3'
(R):5'- CAGCGGAATTTCCAGAAACATAAAG -3'

Sequencing Primer
(F):5'- GGTCATACACTGTTCTGACTAGAAGC -3'
(R):5'- GAATTTGAGCTCTAAAGTAGCTTTCC -3'
Posted On2014-12-29