Incidental Mutation 'R0317:Pum2'
ID 25486
Institutional Source Beutler Lab
Gene Symbol Pum2
Ensembl Gene ENSMUSG00000020594
Gene Name pumilio RNA-binding family member 2
Synonyms 5730503J23Rik, Pumm2
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0317 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 8674134-8752581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8728754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 468 (I468K)
Ref Sequence ENSEMBL: ENSMUSP00000106752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000165293] [ENSMUST00000168361] [ENSMUST00000169089] [ENSMUST00000178015]
AlphaFold Q80U58
Predicted Effect probably benign
Transcript: ENSMUST00000020915
AA Change: I463K

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: I463K

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 319 336 N/A INTRINSIC
low complexity region 353 378 N/A INTRINSIC
low complexity region 464 490 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 542 576 N/A INTRINSIC
low complexity region 591 609 N/A INTRINSIC
Pumilio 642 677 2.35e-7 SMART
Pumilio 678 713 6.54e-6 SMART
Pumilio 714 749 2.89e-7 SMART
Pumilio 750 785 3.37e-8 SMART
Pumilio 786 821 4.84e-9 SMART
Pumilio 822 857 3.2e-9 SMART
Pumilio 858 893 5.78e-7 SMART
Pumilio 901 936 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111122
AA Change: I468K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: I468K

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111123
AA Change: I468K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: I468K

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163569
AA Change: I468K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: I468K

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164818
SMART Domains Protein: ENSMUSP00000129243
Gene: ENSMUSG00000020594

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
Pumilio 75 110 2.35e-7 SMART
Pumilio 111 139 1.58e1 SMART
Pumilio 140 175 3.37e-8 SMART
Pumilio 176 211 4.84e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165293
Predicted Effect possibly damaging
Transcript: ENSMUST00000168361
AA Change: I468K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: I468K

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169089
AA Change: I468K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: I468K

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178015
AA Change: I468K

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: I468K

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Pum2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Pum2 APN 12 8733381 missense probably damaging 1.00
IGL02118:Pum2 APN 12 8729117 missense probably benign 0.31
IGL02185:Pum2 APN 12 8748955 critical splice donor site probably null
IGL02528:Pum2 APN 12 8728696 nonsense probably null
IGL02718:Pum2 APN 12 8733344 missense probably benign 0.02
Plumbat UTSW 12 8728779 critical splice donor site probably null
Pummie UTSW 12 8713906 nonsense probably null
Yorkshire UTSW 12 8728726 nonsense probably null
PIT4366001:Pum2 UTSW 12 8733390 missense probably damaging 1.00
R0152:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0357:Pum2 UTSW 12 8721785 missense possibly damaging 0.92
R0413:Pum2 UTSW 12 8713464 missense probably benign 0.00
R0494:Pum2 UTSW 12 8721736 nonsense probably null
R0520:Pum2 UTSW 12 8721710 missense probably damaging 1.00
R0727:Pum2 UTSW 12 8744465 missense probably damaging 1.00
R1576:Pum2 UTSW 12 8713524 missense probably benign 0.01
R2035:Pum2 UTSW 12 8728638 nonsense probably null
R2060:Pum2 UTSW 12 8728726 nonsense probably null
R2422:Pum2 UTSW 12 8748931 missense possibly damaging 0.70
R2437:Pum2 UTSW 12 8744654 missense probably benign 0.19
R3767:Pum2 UTSW 12 8719076 nonsense probably null
R4715:Pum2 UTSW 12 8747272 missense probably damaging 1.00
R5155:Pum2 UTSW 12 8713572 missense possibly damaging 0.79
R5226:Pum2 UTSW 12 8713458 missense possibly damaging 0.73
R5323:Pum2 UTSW 12 8744706 missense probably damaging 1.00
R6250:Pum2 UTSW 12 8744755 splice site probably null
R6253:Pum2 UTSW 12 8748205 missense probably damaging 1.00
R6508:Pum2 UTSW 12 8748861 missense probably benign 0.17
R6953:Pum2 UTSW 12 8728779 critical splice donor site probably null
R7135:Pum2 UTSW 12 8728952 missense possibly damaging 0.80
R7355:Pum2 UTSW 12 8713906 nonsense probably null
R7586:Pum2 UTSW 12 8747206 missense probably damaging 1.00
R7683:Pum2 UTSW 12 8728922 missense possibly damaging 0.93
R7869:Pum2 UTSW 12 8713595 missense probably benign 0.00
R7873:Pum2 UTSW 12 8748802 missense possibly damaging 0.94
R7980:Pum2 UTSW 12 8713904 missense probably damaging 0.98
R8166:Pum2 UTSW 12 8721739 missense possibly damaging 0.71
R8316:Pum2 UTSW 12 8713456 missense possibly damaging 0.89
R8345:Pum2 UTSW 12 8709454 missense probably damaging 0.99
R8418:Pum2 UTSW 12 8710245 missense possibly damaging 0.87
R8802:Pum2 UTSW 12 8728726 nonsense probably null
R9039:Pum2 UTSW 12 8744430 missense probably damaging 1.00
R9207:Pum2 UTSW 12 8713904 missense probably damaging 0.98
R9366:Pum2 UTSW 12 8733344 missense probably benign 0.02
X0039:Pum2 UTSW 12 8728944 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTGTCTCTTCATAACTGACCAAATG -3'
(R):5'- GAGCTGTTAGTCAAAGAGCTGCTCC -3'

Sequencing Primer
(F):5'- ACTTAGTTCTTGGAAGCCTATAGC -3'
(R):5'- ctgctgctgctgctgTG -3'
Posted On 2013-04-16