Mutagenetix > Incidental Mutations

Incidental Mutation 'R0317:Pum2'

25486

Institutional Source

Beutler Lab

Gene Symbol

Pum2

Ensembl Gene

ENSMUSG00000020594

Gene Name

pumilio RNA-binding family member 2

Synonyms

5730503J23Rik, Pumm2

MMRRC Submission

038527-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0317 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8674134-8752581 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8728754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 468 (I468K)

Ref Sequence

ENSEMBL: ENSMUSP00000106752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000165293] [ENSMUST00000168361] [ENSMUST00000169089] [ENSMUST00000178015]

AlphaFold

Q80U58

Predicted Effect

probably benign
Transcript: ENSMUST00000020915
AA Change: I463K

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: I463K

Domain	Start	End	E-Value	Type
low complexity region	193	206	N/A	INTRINSIC
low complexity region	269	290	N/A	INTRINSIC
low complexity region	319	336	N/A	INTRINSIC
low complexity region	353	378	N/A	INTRINSIC
low complexity region	464	490	N/A	INTRINSIC
low complexity region	498	509	N/A	INTRINSIC
low complexity region	521	535	N/A	INTRINSIC
low complexity region	542	576	N/A	INTRINSIC
low complexity region	591	609	N/A	INTRINSIC
Pumilio	642	677	2.35e-7	SMART
Pumilio	678	713	6.54e-6	SMART
Pumilio	714	749	2.89e-7	SMART
Pumilio	750	785	3.37e-8	SMART
Pumilio	786	821	4.84e-9	SMART
Pumilio	822	857	3.2e-9	SMART
Pumilio	858	893	5.78e-7	SMART
Pumilio	901	936	3.62e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111122
AA Change: I468K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: I468K

Domain	Start	End	E-Value	Type
low complexity region	193	206	N/A	INTRINSIC
low complexity region	269	290	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	358	383	N/A	INTRINSIC
low complexity region	469	495	N/A	INTRINSIC
low complexity region	503	514	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	547	602	N/A	INTRINSIC
low complexity region	630	660	N/A	INTRINSIC
low complexity region	675	693	N/A	INTRINSIC
Pumilio	726	761	2.35e-7	SMART
Pumilio	762	797	6.54e-6	SMART
Pumilio	798	833	2.89e-7	SMART
Pumilio	834	869	3.37e-8	SMART
Pumilio	870	905	4.84e-9	SMART
Pumilio	906	941	3.2e-9	SMART
Pumilio	942	977	5.78e-7	SMART
Pumilio	985	1020	3.62e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111123
AA Change: I468K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: I468K

Domain	Start	End	E-Value	Type
low complexity region	193	206	N/A	INTRINSIC
low complexity region	269	290	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	358	383	N/A	INTRINSIC
low complexity region	469	495	N/A	INTRINSIC
low complexity region	503	514	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	547	602	N/A	INTRINSIC
low complexity region	630	660	N/A	INTRINSIC
low complexity region	675	693	N/A	INTRINSIC
Pumilio	726	761	2.35e-7	SMART
Pumilio	762	797	6.54e-6	SMART
Pumilio	798	833	2.89e-7	SMART
Pumilio	834	869	3.37e-8	SMART
Pumilio	870	905	4.84e-9	SMART
Pumilio	906	941	3.2e-9	SMART
Pumilio	942	977	5.78e-7	SMART
Pumilio	985	1020	3.62e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163569
AA Change: I468K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: I468K

Domain	Start	End	E-Value	Type
low complexity region	193	206	N/A	INTRINSIC
low complexity region	269	290	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	358	383	N/A	INTRINSIC
low complexity region	469	495	N/A	INTRINSIC
low complexity region	503	514	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	547	602	N/A	INTRINSIC
low complexity region	630	660	N/A	INTRINSIC
low complexity region	675	693	N/A	INTRINSIC
Pumilio	726	761	2.35e-7	SMART
Pumilio	762	797	6.54e-6	SMART
Pumilio	798	832	1.29e-4	SMART
Pumilio	836	871	3.37e-8	SMART
Pumilio	872	907	4.84e-9	SMART
Pumilio	908	943	3.2e-9	SMART
Pumilio	944	979	5.78e-7	SMART
Pumilio	987	1022	3.62e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164818

SMART Domains

Protein: ENSMUSP00000129243
Gene: ENSMUSG00000020594

Domain	Start	End	E-Value	Type
low complexity region	24	42	N/A	INTRINSIC
Pumilio	75	110	2.35e-7	SMART
Pumilio	111	139	1.58e1	SMART
Pumilio	140	175	3.37e-8	SMART
Pumilio	176	211	4.84e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165293

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168361
AA Change: I468K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: I468K

Domain	Start	End	E-Value	Type
low complexity region	193	206	N/A	INTRINSIC
low complexity region	269	290	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	358	383	N/A	INTRINSIC
low complexity region	469	495	N/A	INTRINSIC
low complexity region	503	514	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	547	602	N/A	INTRINSIC
low complexity region	630	660	N/A	INTRINSIC
low complexity region	675	693	N/A	INTRINSIC
Pumilio	726	761	2.35e-7	SMART
Pumilio	762	797	6.54e-6	SMART
Pumilio	798	832	1.29e-4	SMART
Pumilio	836	871	3.37e-8	SMART
Pumilio	872	907	4.84e-9	SMART
Pumilio	908	943	3.2e-9	SMART
Pumilio	944	979	5.78e-7	SMART
Pumilio	987	1022	3.62e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169089
AA Change: I468K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: I468K

Domain	Start	End	E-Value	Type
low complexity region	193	206	N/A	INTRINSIC
low complexity region	269	290	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	358	383	N/A	INTRINSIC
low complexity region	469	495	N/A	INTRINSIC
low complexity region	503	514	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	547	581	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
Pumilio	647	682	2.35e-7	SMART
Pumilio	683	718	6.54e-6	SMART
Pumilio	719	754	2.89e-7	SMART
Pumilio	755	790	3.37e-8	SMART
Pumilio	791	826	4.84e-9	SMART
Pumilio	827	862	3.2e-9	SMART
Pumilio	863	898	5.78e-7	SMART
Pumilio	906	941	3.62e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178015
AA Change: I468K

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: I468K

Domain	Start	End	E-Value	Type
low complexity region	193	206	N/A	INTRINSIC
low complexity region	269	290	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	358	383	N/A	INTRINSIC
low complexity region	469	495	N/A	INTRINSIC
low complexity region	503	514	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	547	581	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
Pumilio	647	682	2.35e-7	SMART
Pumilio	683	718	6.54e-6	SMART
Pumilio	719	754	2.89e-7	SMART
Pumilio	755	790	3.37e-8	SMART
Pumilio	791	826	4.84e-9	SMART
Pumilio	827	862	3.2e-9	SMART
Pumilio	863	898	5.78e-7	SMART
Pumilio	906	941	3.62e-8	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,293,459	V1774A	probably damaging	Het
Adam34	G	A	8: 43,652,251	P119L	probably benign	Het
Ap3b2	T	C	7: 81,463,681		probably null	Het
Arfip2	G	A	7: 105,637,223	T124M	probably damaging	Het
Arhgef26	T	C	3: 62,423,544	S560P	probably damaging	Het
Bcl11a	A	T	11: 24,172,697		probably null	Het
Cab39	A	G	1: 85,849,160	E322G	probably damaging	Het
Cad	C	A	5: 31,072,321	P1382Q	probably benign	Het
Cc2d2a	T	C	5: 43,706,901		probably null	Het
Cela2a	A	T	4: 141,821,700		probably null	Het
Ces1e	A	C	8: 93,224,039	I38S	probably benign	Het
Ces1f	A	T	8: 93,263,391	F364I	probably benign	Het
Chgb	A	G	2: 132,793,811	T558A	probably benign	Het
Cnpy4	C	T	5: 138,192,812	Q217*	probably null	Het
Col4a3bp	C	T	13: 96,634,121	R487*	probably null	Het
Crlf1	A	G	8: 70,498,599	T43A	probably benign	Het
Dnah7b	T	A	1: 46,134,656	M707K	probably damaging	Het
Ets2	G	A	16: 95,712,149	S123N	probably damaging	Het
Fam196b	C	A	11: 34,402,826	D289E	possibly damaging	Het
Fry	T	C	5: 150,471,468	F304S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,116	R120H	probably benign	Het
Gbf1	A	G	19: 46,254,020	T96A	probably benign	Het
Ggn	T	A	7: 29,171,090	M1K	probably null	Het
Gm5239	A	G	18: 35,536,916	T112A	probably benign	Het
Kif1bp	A	T	10: 62,578,082		probably null	Het
Lrrc15	A	T	16: 30,273,743	H259Q	probably benign	Het
Lysmd4	A	G	7: 67,226,297	Y236C	probably damaging	Het
Med29	T	C	7: 28,386,859	T175A	possibly damaging	Het
Mfsd12	G	T	10: 81,357,799	D68Y	probably damaging	Het
Myh1	T	C	11: 67,217,512	L1308P	probably damaging	Het
Nphp4	T	A	4: 152,551,931		probably null	Het
Olfr948	A	G	9: 39,319,461	I51T	probably benign	Het
Pdhx	A	G	2: 103,028,280	V393A	probably benign	Het
Pgm5	A	G	19: 24,824,399	I155T	possibly damaging	Het
Pgr	A	T	9: 8,965,022	I889F	probably benign	Het
Phactr4	T	A	4: 132,386,930	K51I	probably damaging	Het
Rab11a	A	G	9: 64,725,553	S24P	probably damaging	Het
Rasef	T	C	4: 73,748,562	Q160R	probably damaging	Het
Rbl2	A	G	8: 91,087,144	D339G	probably benign	Het
Recql5	A	G	11: 115,894,673	S666P	probably benign	Het
Rfc1	A	T	5: 65,296,052		probably null	Het
Scarb1	A	G	5: 125,289,692	V59A	probably damaging	Het
Slc2a4	C	T	11: 69,946,356	V85M	probably damaging	Het
Slc6a12	A	G	6: 121,358,625	I291V	possibly damaging	Het
Slco3a1	A	C	7: 74,504,426	Y104D	probably damaging	Het
Suz12	T	A	11: 79,999,078	D13E	probably damaging	Het
Tlr1	G	T	5: 64,925,967	C422*	probably null	Het
Tmco1	T	C	1: 167,325,893	V114A	probably damaging	Het
Trpa1	T	C	1: 14,881,632	T948A	probably benign	Het
Tub	A	T	7: 109,020,927	N93Y	probably damaging	Het
Ufsp2	G	A	8: 45,992,233		probably null	Het
Veph1	T	C	3: 66,171,975	D373G	probably benign	Het
Vmn1r206	A	G	13: 22,620,960	S26P	possibly damaging	Het
Vmn2r1	T	C	3: 64,081,819	S60P	possibly damaging	Het
Wdcp	A	G	12: 4,851,583	S480G	probably benign	Het
Wnk4	T	C	11: 101,268,804	S612P	probably benign	Het
Zfp503	T	C	14: 21,986,459	K130E	probably benign	Het
Zkscan16	G	A	4: 58,957,602	C628Y	possibly damaging	Het

Other mutations in Pum2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Pum2	APN	12	8733381	missense	probably damaging	1.00
IGL02118:Pum2	APN	12	8729117	missense	probably benign	0.31
IGL02185:Pum2	APN	12	8748955	critical splice donor site	probably null
IGL02528:Pum2	APN	12	8728696	nonsense	probably null
IGL02718:Pum2	APN	12	8733344	missense	probably benign	0.02
Plumbat	UTSW	12	8728779	critical splice donor site	probably null
Pummie	UTSW	12	8713906	nonsense	probably null
Yorkshire	UTSW	12	8728726	nonsense	probably null
PIT4366001:Pum2	UTSW	12	8733390	missense	probably damaging	1.00
R0152:Pum2	UTSW	12	8728754	missense	possibly damaging	0.94
R0357:Pum2	UTSW	12	8721785	missense	possibly damaging	0.92
R0413:Pum2	UTSW	12	8713464	missense	probably benign	0.00
R0494:Pum2	UTSW	12	8721736	nonsense	probably null
R0520:Pum2	UTSW	12	8721710	missense	probably damaging	1.00
R0727:Pum2	UTSW	12	8744465	missense	probably damaging	1.00
R1576:Pum2	UTSW	12	8713524	missense	probably benign	0.01
R2035:Pum2	UTSW	12	8728638	nonsense	probably null
R2060:Pum2	UTSW	12	8728726	nonsense	probably null
R2422:Pum2	UTSW	12	8748931	missense	possibly damaging	0.70
R2437:Pum2	UTSW	12	8744654	missense	probably benign	0.19
R3767:Pum2	UTSW	12	8719076	nonsense	probably null
R4715:Pum2	UTSW	12	8747272	missense	probably damaging	1.00
R5155:Pum2	UTSW	12	8713572	missense	possibly damaging	0.79
R5226:Pum2	UTSW	12	8713458	missense	possibly damaging	0.73
R5323:Pum2	UTSW	12	8744706	missense	probably damaging	1.00
R6250:Pum2	UTSW	12	8744755	splice site	probably null
R6253:Pum2	UTSW	12	8748205	missense	probably damaging	1.00
R6508:Pum2	UTSW	12	8748861	missense	probably benign	0.17
R6953:Pum2	UTSW	12	8728779	critical splice donor site	probably null
R7135:Pum2	UTSW	12	8728952	missense	possibly damaging	0.80
R7355:Pum2	UTSW	12	8713906	nonsense	probably null
R7586:Pum2	UTSW	12	8747206	missense	probably damaging	1.00
R7683:Pum2	UTSW	12	8728922	missense	possibly damaging	0.93
R7869:Pum2	UTSW	12	8713595	missense	probably benign	0.00
R7873:Pum2	UTSW	12	8748802	missense	possibly damaging	0.94
R7980:Pum2	UTSW	12	8713904	missense	probably damaging	0.98
R8166:Pum2	UTSW	12	8721739	missense	possibly damaging	0.71
R8316:Pum2	UTSW	12	8713456	missense	possibly damaging	0.89
R8345:Pum2	UTSW	12	8709454	missense	probably damaging	0.99
R8418:Pum2	UTSW	12	8710245	missense	possibly damaging	0.87
R8802:Pum2	UTSW	12	8728726	nonsense	probably null
R9039:Pum2	UTSW	12	8744430	missense	probably damaging	1.00
R9207:Pum2	UTSW	12	8713904	missense	probably damaging	0.98
R9366:Pum2	UTSW	12	8733344	missense	probably benign	0.02
X0039:Pum2	UTSW	12	8728944	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCCTGTCTCTTCATAACTGACCAAATG -3'
(R):5'- GAGCTGTTAGTCAAAGAGCTGCTCC -3'

Sequencing Primer
(F):5'- ACTTAGTTCTTGGAAGCCTATAGC -3'
(R):5'- ctgctgctgctgctgTG -3'

Posted On

2013-04-16