Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Dusp13'

254860

Institutional Source

Beutler Lab

Gene Symbol

Dusp13

Ensembl Gene

ENSMUSG00000021768

Gene Name

dual specificity phosphatase 13

Synonyms

TMDP, TS-DSP6, LMW-DSP6, LOC382853

MMRRC Submission

040502-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21733394-21751181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21740137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 47 (N47I)

Ref Sequence

ENSEMBL: ENSMUSP00000138972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075040] [ENSMUST00000119866] [ENSMUST00000120956] [ENSMUST00000120984] [ENSMUST00000127851] [ENSMUST00000153071] [ENSMUST00000183698] [ENSMUST00000183943] [ENSMUST00000184703] [ENSMUST00000184571] [ENSMUST00000183893] [ENSMUST00000185042]

AlphaFold

Q9QYJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000075040

SMART Domains

Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
DSPc	37	181	7.66e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119866
AA Change: N165I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112552
Gene: ENSMUSG00000021768
AA Change: N165I

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120956
AA Change: N112I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113305
Gene: ENSMUSG00000021768
AA Change: N112I

Domain	Start	End	E-Value	Type
DSPc	110	255	9.29e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120984
AA Change: N47I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113985
Gene: ENSMUSG00000021768
AA Change: N47I

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127051

SMART Domains

Protein: ENSMUSP00000127910
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
DSPc	9	142	2.4e-24	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000127851
AA Change: Q266H

SMART Domains

Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768
AA Change: Q266H

Domain	Start	End	E-Value	Type
SCOP:d1vhra_	20	133	9e-10	SMART
Blast:DSPc	37	129	5e-60	BLAST
PDB:2E0T\|A	39	129	1e-26	PDB
low complexity region	162	173	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141004

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141656

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142076

Predicted Effect

probably benign
Transcript: ENSMUST00000153071

SMART Domains

Protein: ENSMUSP00000139140
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
Pfam:DSPc	1	48	5.2e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000183698
AA Change: N70I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139058
Gene: ENSMUSG00000021768
AA Change: N70I

Domain	Start	End	E-Value	Type
DSPc	68	213	9.29e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183824

Predicted Effect

probably damaging
Transcript: ENSMUST00000183943
AA Change: N97I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768
AA Change: N97I

Domain	Start	End	E-Value	Type
internal_repeat_1	19	71	6.78e-8	PROSPERO
DSPc	95	240	9.29e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000184703
AA Change: N47I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138972
Gene: ENSMUSG00000021768
AA Change: N47I

Domain	Start	End	E-Value	Type
DSPc	45	190	9.29e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184571

Predicted Effect

probably benign
Transcript: ENSMUST00000183893

SMART Domains

Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185042

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap11a	A	G	2: 113,833,508	V810A	probably damaging	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Col5a2	C	G	1: 45,413,496	G358R	probably damaging	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gabrb2	T	A	11: 42,591,907	N197K	probably benign	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Rnf20	A	G	4: 49,638,769	E197G	probably benign	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Tyrp1	A	G	4: 80,837,455	T154A	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfhx2	G	T	14: 55,064,557	P1990Q	probably damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Dusp13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01803:Dusp13	APN	14	21733839	missense	probably damaging	1.00
IGL02963:Dusp13	APN	14	21733807	missense	possibly damaging	0.86
R0827:Dusp13	UTSW	14	21742771	missense	probably benign
R1185:Dusp13	UTSW	14	21735018	missense	probably damaging	1.00
R1185:Dusp13	UTSW	14	21735018	missense	probably damaging	1.00
R1185:Dusp13	UTSW	14	21735018	missense	probably damaging	1.00
R1882:Dusp13	UTSW	14	21734975	missense	probably benign	0.04
R3954:Dusp13	UTSW	14	21740107	missense	probably damaging	1.00
R4623:Dusp13	UTSW	14	21743478	unclassified	probably benign
R4837:Dusp13	UTSW	14	21743525	utr 3 prime	probably benign
R6713:Dusp13	UTSW	14	21748473	missense	probably damaging	1.00
R7294:Dusp13	UTSW	14	21733714	missense	possibly damaging	0.47
R7782:Dusp13	UTSW	14	21741336	missense	possibly damaging	0.86
R8088:Dusp13	UTSW	14	21741237	missense	probably benign	0.33
R8176:Dusp13	UTSW	14	21747481	missense	possibly damaging	0.81
R8227:Dusp13	UTSW	14	21742801	missense	probably benign
R8520:Dusp13	UTSW	14	21743470	nonsense	probably null
R8724:Dusp13	UTSW	14	21746407	missense	probably benign	0.04
R8973:Dusp13	UTSW	14	21734906	missense	probably benign	0.01
R9031:Dusp13	UTSW	14	21740165	missense	probably benign	0.00
R9142:Dusp13	UTSW	14	21742688	missense	probably benign	0.30
R9186:Dusp13	UTSW	14	21748495	missense	probably damaging	0.97
R9258:Dusp13	UTSW	14	21741087	missense	probably benign	0.44
R9630:Dusp13	UTSW	14	21734906	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGCCTGAAAGATGAAACTGTATG -3'
(R):5'- CGGGTAATAGCCTCATTCAGC -3'

Sequencing Primer
(F):5'- TGTTTCCAAACAAACATGAGAAAGGC -3'
(R):5'- GGGTAATAGCCTCATTCAGCATAGC -3'

Posted On

2014-12-29