Incidental Mutation 'R2915:Dusp13b'
ID 254860
Institutional Source Beutler Lab
Gene Symbol Dusp13b
Ensembl Gene ENSMUSG00000021768
Gene Name dual specificity phosphatase 13B
Synonyms TS-DSP6, TMDP, Dusp13, LMW-DSP6, LOC382853
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2915 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 21783463-21792947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21790205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 47 (N47I)
Ref Sequence ENSEMBL: ENSMUSP00000138972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075040] [ENSMUST00000119866] [ENSMUST00000120956] [ENSMUST00000120984] [ENSMUST00000127851] [ENSMUST00000183698] [ENSMUST00000183943] [ENSMUST00000184703] [ENSMUST00000184571] [ENSMUST00000183893] [ENSMUST00000153071] [ENSMUST00000185042]
AlphaFold Q9QYJ7
Predicted Effect probably benign
Transcript: ENSMUST00000075040
SMART Domains Protein: ENSMUSP00000074553
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 37 181 7.66e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119866
AA Change: N165I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112552
Gene: ENSMUSG00000021768
AA Change: N165I

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120956
AA Change: N112I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113305
Gene: ENSMUSG00000021768
AA Change: N112I

DomainStartEndE-ValueType
DSPc 110 255 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120984
AA Change: N47I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113985
Gene: ENSMUSG00000021768
AA Change: N47I

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127051
SMART Domains Protein: ENSMUSP00000127910
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
DSPc 9 142 2.4e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000127851
AA Change: Q266H
SMART Domains Protein: ENSMUSP00000120977
Gene: ENSMUSG00000021768
AA Change: Q266H

DomainStartEndE-ValueType
SCOP:d1vhra_ 20 133 9e-10 SMART
Blast:DSPc 37 129 5e-60 BLAST
PDB:2E0T|A 39 129 1e-26 PDB
low complexity region 162 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183824
Predicted Effect probably damaging
Transcript: ENSMUST00000183698
AA Change: N70I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139058
Gene: ENSMUSG00000021768
AA Change: N70I

DomainStartEndE-ValueType
DSPc 68 213 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183943
AA Change: N97I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139154
Gene: ENSMUSG00000021768
AA Change: N97I

DomainStartEndE-ValueType
internal_repeat_1 19 71 6.78e-8 PROSPERO
DSPc 95 240 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184703
AA Change: N47I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138972
Gene: ENSMUSG00000021768
AA Change: N47I

DomainStartEndE-ValueType
DSPc 45 190 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141004
Predicted Effect probably benign
Transcript: ENSMUST00000184571
Predicted Effect probably benign
Transcript: ENSMUST00000183893
SMART Domains Protein: ENSMUSP00000139061
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153071
SMART Domains Protein: ENSMUSP00000139140
Gene: ENSMUSG00000021768

DomainStartEndE-ValueType
Pfam:DSPc 1 48 5.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185042
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Elmo2 A G 2: 165,139,573 (GRCm39) probably benign Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gabrb2 T A 11: 42,482,734 (GRCm39) N197K probably benign Het
Gdnf T A 15: 7,845,130 (GRCm39) V41E possibly damaging Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Ice2 A G 9: 69,318,122 (GRCm39) D241G probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or5t9 T C 2: 86,659,570 (GRCm39) I158T probably benign Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pax1 A G 2: 147,210,348 (GRCm39) Y361C probably damaging Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zfp853 T C 5: 143,275,332 (GRCm39) E96G unknown Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Dusp13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Dusp13b APN 14 21,783,907 (GRCm39) missense probably damaging 1.00
IGL02963:Dusp13b APN 14 21,783,875 (GRCm39) missense possibly damaging 0.86
R0827:Dusp13b UTSW 14 21,792,839 (GRCm39) missense probably benign
R1185:Dusp13b UTSW 14 21,785,086 (GRCm39) missense probably damaging 1.00
R1185:Dusp13b UTSW 14 21,785,086 (GRCm39) missense probably damaging 1.00
R1185:Dusp13b UTSW 14 21,785,086 (GRCm39) missense probably damaging 1.00
R1882:Dusp13b UTSW 14 21,785,043 (GRCm39) missense probably benign 0.04
R3954:Dusp13b UTSW 14 21,790,175 (GRCm39) missense probably damaging 1.00
R4623:Dusp13b UTSW 14 21,793,546 (GRCm39) unclassified probably benign
R4837:Dusp13b UTSW 14 21,793,593 (GRCm39) utr 3 prime probably benign
R6713:Dusp13b UTSW 14 21,798,541 (GRCm39) missense probably damaging 1.00
R7294:Dusp13b UTSW 14 21,783,782 (GRCm39) missense possibly damaging 0.47
R7782:Dusp13b UTSW 14 21,791,404 (GRCm39) missense possibly damaging 0.86
R8088:Dusp13b UTSW 14 21,791,305 (GRCm39) missense probably benign 0.33
R8176:Dusp13b UTSW 14 21,797,549 (GRCm39) missense possibly damaging 0.81
R8227:Dusp13b UTSW 14 21,792,869 (GRCm39) missense probably benign
R8520:Dusp13b UTSW 14 21,793,538 (GRCm39) nonsense probably null
R8724:Dusp13b UTSW 14 21,796,475 (GRCm39) missense probably benign 0.04
R8973:Dusp13b UTSW 14 21,784,974 (GRCm39) missense probably benign 0.01
R9031:Dusp13b UTSW 14 21,790,233 (GRCm39) missense probably benign 0.00
R9142:Dusp13b UTSW 14 21,792,756 (GRCm39) missense probably benign 0.30
R9186:Dusp13b UTSW 14 21,798,563 (GRCm39) missense probably damaging 0.97
R9258:Dusp13b UTSW 14 21,791,155 (GRCm39) missense probably benign 0.44
R9630:Dusp13b UTSW 14 21,784,974 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCCTGAAAGATGAAACTGTATG -3'
(R):5'- CGGGTAATAGCCTCATTCAGC -3'

Sequencing Primer
(F):5'- TGTTTCCAAACAAACATGAGAAAGGC -3'
(R):5'- GGGTAATAGCCTCATTCAGCATAGC -3'
Posted On 2014-12-29