Mutagenetix > Incidental Mutation

Incidental Mutation 'R2915:Zfhx2'

254862

Institutional Source

Beutler Lab

Gene Symbol

Zfhx2

Ensembl Gene

ENSMUSG00000040721

Gene Name

zinc finger homeobox 2

Synonyms

zfh-5

MMRRC Submission

040502-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.406) question?

Stock #

R2915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55060262-55092324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 55064557 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 1990 (P1990Q)

Ref Sequence

ENSEMBL: ENSMUSP00000045156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]

AlphaFold

Q2MHN3

Predicted Effect

probably damaging
Transcript: ENSMUST00000036328
AA Change: P1990Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: P1990Q

Domain	Start	End	E-Value	Type
low complexity region	22	42	N/A	INTRINSIC
ZnF_C2H2	230	252	1.43e1	SMART
low complexity region	333	345	N/A	INTRINSIC
low complexity region	428	439	N/A	INTRINSIC
ZnF_C2H2	446	469	8.94e-3	SMART
ZnF_U1	498	532	6.98e-1	SMART
ZnF_C2H2	501	525	3.21e-4	SMART
ZnF_U1	560	594	1.36e0	SMART
ZnF_C2H2	563	587	3.29e-1	SMART
low complexity region	597	623	N/A	INTRINSIC
ZnF_C2H2	752	776	6.4e0	SMART
ZnF_C2H2	815	839	2.02e-1	SMART
ZnF_U1	861	895	1.78e1	SMART
ZnF_C2H2	864	888	5.34e-1	SMART
ZnF_C2H2	974	997	1.51e1	SMART
ZnF_C2H2	1003	1026	1.51e0	SMART
low complexity region	1087	1103	N/A	INTRINSIC
low complexity region	1106	1126	N/A	INTRINSIC
ZnF_U1	1182	1216	3.42e0	SMART
ZnF_C2H2	1185	1209	8.22e-2	SMART
ZnF_U1	1239	1273	3.73e0	SMART
ZnF_C2H2	1242	1266	6.67e-2	SMART
low complexity region	1277	1304	N/A	INTRINSIC
low complexity region	1314	1326	N/A	INTRINSIC
low complexity region	1332	1346	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
low complexity region	1379	1400	N/A	INTRINSIC
low complexity region	1457	1465	N/A	INTRINSIC
ZnF_C2H2	1474	1497	5.34e0	SMART
low complexity region	1522	1531	N/A	INTRINSIC
low complexity region	1542	1554	N/A	INTRINSIC
low complexity region	1562	1583	N/A	INTRINSIC
HOX	1589	1651	1.97e-16	SMART
low complexity region	1656	1665	N/A	INTRINSIC
coiled coil region	1693	1723	N/A	INTRINSIC
ZnF_C2H2	1761	1783	2.53e-2	SMART
low complexity region	1837	1847	N/A	INTRINSIC
HOX	1851	1913	2.34e-18	SMART
low complexity region	1984	1995	N/A	INTRINSIC
low complexity region	2001	2051	N/A	INTRINSIC
HOX	2058	2120	1.52e-17	SMART
ZnF_U1	2136	2170	1.09e1	SMART
ZnF_C2H2	2139	2163	5.4e1	SMART
low complexity region	2328	2354	N/A	INTRINSIC
low complexity region	2385	2426	N/A	INTRINSIC
ZnF_U1	2482	2516	8.31e-1	SMART
ZnF_C2H2	2485	2509	9.46e0	SMART
low complexity region	2523	2538	N/A	INTRINSIC
low complexity region	2553	2562	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176665

SMART Domains

Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

Domain	Start	End	E-Value	Type
ZnF_C2H2	13	37	5.34e-1	SMART
ZnF_C2H2	133	156	1.51e1	SMART
ZnF_C2H2	162	185	1.51e0	SMART
low complexity region	246	262	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
ZnF_C2H2	344	368	8.22e-2	SMART
ZnF_C2H2	401	425	6.67e-2	SMART
low complexity region	436	463	N/A	INTRINSIC
low complexity region	473	485	N/A	INTRINSIC
low complexity region	491	505	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
low complexity region	538	559	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176872

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183750

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183822

SMART Domains

Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

Domain	Start	End	E-Value	Type
PDB:2JMU\|A	5	64	3e-23	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185121

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (50/51)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Arhgap11a	A	G	2: 113,833,508	V810A	probably damaging	Het
B3gnt6	T	C	7: 98,193,593	N387D	probably benign	Het
Col5a2	C	G	1: 45,413,496	G358R	probably damaging	Het
Cracr2a	A	G	6: 127,611,505	K209R	probably damaging	Het
Dmkn	A	G	7: 30,765,316	N32S	unknown	Het
Dusp13	T	A	14: 21,740,137	N47I	probably damaging	Het
Elmo2	A	G	2: 165,297,653		probably benign	Het
Ephb6	T	C	6: 41,614,238	F110L	probably damaging	Het
Gabrb2	T	A	11: 42,591,907	N197K	probably benign	Het
Gdnf	T	A	15: 7,815,649	V41E	possibly damaging	Het
Gm21915	A	G	9: 40,670,787	I59V	possibly damaging	Het
Gprin2	C	T	14: 34,195,081	G244D	possibly damaging	Het
Grin2d	T	C	7: 45,833,357		probably benign	Het
Ice2	A	G	9: 69,410,840	D241G	probably benign	Het
Mios	C	T	6: 8,214,935	R44C	possibly damaging	Het
Nlrp5-ps	T	C	7: 14,586,711		noncoding transcript	Het
Nyap2	C	T	1: 81,087,471	R67*	probably null	Het
Olfr1031	T	A	2: 85,992,045	V76E	probably damaging	Het
Olfr1094	T	C	2: 86,829,226	I158T	probably benign	Het
Olfr1306	G	T	2: 111,912,719	D70E	probably damaging	Het
Olfr1428	G	A	19: 12,108,625	P81L	probably benign	Het
Olfr27	G	T	9: 39,144,466	R122L	possibly damaging	Het
Otop2	G	A	11: 115,329,146	A271T	probably benign	Het
Otulin	A	G	15: 27,619,630		probably benign	Het
Pax1	A	G	2: 147,368,428	Y361C	probably damaging	Het
Pcdhb12	A	T	18: 37,437,640	N613I	probably damaging	Het
Plekha5	A	G	6: 140,589,199	K173E	probably damaging	Het
Plin4	T	A	17: 56,104,389	T881S	probably damaging	Het
Poli	A	G	18: 70,522,700		probably null	Het
Prex2	T	A	1: 11,169,853	F898I	probably damaging	Het
Prr14l	A	T	5: 32,829,768	H794Q	probably benign	Het
Prss1	A	T	6: 41,462,611	I93F	probably benign	Het
Ptpro	C	T	6: 137,414,241		probably benign	Het
Rad1	T	C	15: 10,486,642	C42R	probably damaging	Het
Rnf20	A	G	4: 49,638,769	E197G	probably benign	Het
Setx	A	G	2: 29,172,324	E2260G	probably damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Six2	A	G	17: 85,685,188	S296P	probably damaging	Het
Smg1	T	A	7: 118,210,879		probably benign	Het
Spred2	T	C	11: 19,998,215	V41A	probably damaging	Het
Ssu2	A	T	6: 112,377,605	C219*	probably null	Het
Tbc1d9b	T	A	11: 50,149,736	V360D	possibly damaging	Het
Tdrd9	G	A	12: 112,040,461	D920N	probably damaging	Het
Tyrp1	A	G	4: 80,837,455	T154A	possibly damaging	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Wac	A	C	18: 7,926,131	M596L	possibly damaging	Het
Zfp853	T	C	5: 143,289,577	E96G	unknown	Het
Zzef1	G	A	11: 72,910,326		probably null	Het

Other mutations in Zfhx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Zfhx2	APN	14	55066565	missense	possibly damaging	0.93
IGL00164:Zfhx2	APN	14	55065026	missense	possibly damaging	0.73
IGL00235:Zfhx2	APN	14	55063257	missense	probably benign	0.11
IGL00925:Zfhx2	APN	14	55073061	missense	probably benign	0.06
IGL01025:Zfhx2	APN	14	55064260	missense	probably damaging	1.00
IGL01061:Zfhx2	APN	14	55073882	missense	possibly damaging	0.96
IGL01486:Zfhx2	APN	14	55067090	missense	probably damaging	1.00
IGL01875:Zfhx2	APN	14	55063915	missense	unknown
IGL01990:Zfhx2	APN	14	55073590	missense	probably damaging	0.99
IGL02097:Zfhx2	APN	14	55062894	missense	probably damaging	1.00
IGL02269:Zfhx2	APN	14	55071936	missense	probably benign	0.00
IGL02488:Zfhx2	APN	14	55065103	missense	possibly damaging	0.72
IGL02624:Zfhx2	APN	14	55066628	missense	probably benign	0.06
IGL03087:Zfhx2	APN	14	55072845	missense	possibly damaging	0.85
G1patch:Zfhx2	UTSW	14	55064082	nonsense	probably null
PIT4403001:Zfhx2	UTSW	14	55074980	missense	probably benign
R0148:Zfhx2	UTSW	14	55072897	missense	possibly damaging	0.86
R0323:Zfhx2	UTSW	14	55065979	missense	possibly damaging	0.73
R0328:Zfhx2	UTSW	14	55071988	missense	probably benign
R0348:Zfhx2	UTSW	14	55063508	missense	probably damaging	0.99
R0442:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R0533:Zfhx2	UTSW	14	55064090	missense	probably benign	0.23
R0561:Zfhx2	UTSW	14	55065889	missense	probably benign	0.01
R0627:Zfhx2	UTSW	14	55065327	missense	probably benign
R0659:Zfhx2	UTSW	14	55073801	missense	possibly damaging	0.73
R0675:Zfhx2	UTSW	14	55063163	missense	probably damaging	0.99
R1301:Zfhx2	UTSW	14	55063397	missense	probably benign	0.32
R1563:Zfhx2	UTSW	14	55065088	missense	probably benign	0.33
R1607:Zfhx2	UTSW	14	55062985	missense	probably damaging	1.00
R1694:Zfhx2	UTSW	14	55073944	missense	possibly damaging	0.91
R1710:Zfhx2	UTSW	14	55065998	missense	possibly damaging	0.70
R1773:Zfhx2	UTSW	14	55072891	missense	possibly damaging	0.53
R1879:Zfhx2	UTSW	14	55065617	missense	probably benign	0.32
R1879:Zfhx2	UTSW	14	55072749	missense	possibly damaging	0.96
R1933:Zfhx2	UTSW	14	55075238	start gained	probably benign
R1944:Zfhx2	UTSW	14	55074732	missense	probably benign	0.18
R2888:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R2889:Zfhx2	UTSW	14	55064803	missense	possibly damaging	0.71
R3971:Zfhx2	UTSW	14	55074475	missense	probably benign	0.33
R4082:Zfhx2	UTSW	14	55065205	missense	probably benign
R4134:Zfhx2	UTSW	14	55065143	missense	possibly damaging	0.93
R4231:Zfhx2	UTSW	14	55073534	missense	possibly damaging	0.73
R4675:Zfhx2	UTSW	14	55067221	missense	probably benign	0.03
R4764:Zfhx2	UTSW	14	55066915	missense	possibly damaging	0.96
R4866:Zfhx2	UTSW	14	55065536	missense	possibly damaging	0.73
R4940:Zfhx2	UTSW	14	55066434	missense	possibly damaging	0.53
R5125:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5178:Zfhx2	UTSW	14	55074775	missense	probably benign	0.00
R5554:Zfhx2	UTSW	14	55064317	missense	probably damaging	1.00
R5689:Zfhx2	UTSW	14	55073903	missense	possibly damaging	0.53
R5768:Zfhx2	UTSW	14	55074365	missense	probably benign
R5792:Zfhx2	UTSW	14	55066846	missense	possibly damaging	0.72
R5834:Zfhx2	UTSW	14	55073330	nonsense	probably null
R5895:Zfhx2	UTSW	14	55065891	missense	probably benign
R5999:Zfhx2	UTSW	14	55074005	missense	probably benign
R6025:Zfhx2	UTSW	14	55065208	missense	probably benign	0.00
R6106:Zfhx2	UTSW	14	55068310	critical splice acceptor site	probably null
R6135:Zfhx2	UTSW	14	55074196	missense	possibly damaging	0.85
R6186:Zfhx2	UTSW	14	55063160	missense	probably damaging	0.99
R6379:Zfhx2	UTSW	14	55074338	missense	probably benign
R6725:Zfhx2	UTSW	14	55064082	nonsense	probably null
R7089:Zfhx2	UTSW	14	55065772	missense	probably benign	0.33
R7383:Zfhx2	UTSW	14	55068253	missense	probably benign	0.00
R7470:Zfhx2	UTSW	14	55066750	missense	possibly damaging	0.52
R7606:Zfhx2	UTSW	14	55066663	missense	probably benign	0.12
R7607:Zfhx2	UTSW	14	55066231	missense	possibly damaging	0.86
R7698:Zfhx2	UTSW	14	55062849	missense	probably benign	0.00
R7730:Zfhx2	UTSW	14	55066900	missense	possibly damaging	0.53
R8142:Zfhx2	UTSW	14	55073438	missense	possibly damaging	0.86
R8188:Zfhx2	UTSW	14	55064441	missense	probably benign	0.18
R8212:Zfhx2	UTSW	14	55072916	missense	possibly damaging	0.70
R8264:Zfhx2	UTSW	14	55065512	missense	possibly damaging	0.53
R8331:Zfhx2	UTSW	14	55071987	missense	probably benign	0.00
R8369:Zfhx2	UTSW	14	55066744	missense	probably benign	0.05
R8371:Zfhx2	UTSW	14	55064092	missense	probably damaging	0.99
R8383:Zfhx2	UTSW	14	55074071	missense	possibly damaging	0.73
R8415:Zfhx2	UTSW	14	55070622	missense	probably benign
R8441:Zfhx2	UTSW	14	55066528	missense	possibly damaging	0.96
R8466:Zfhx2	UTSW	14	55072896	missense	possibly damaging	0.53
R8504:Zfhx2	UTSW	14	55065786	missense	probably benign	0.00
R8708:Zfhx2	UTSW	14	55075052	missense	probably benign
R8804:Zfhx2	UTSW	14	55074734	missense	probably benign	0.18
R8913:Zfhx2	UTSW	14	55072086	missense	probably benign	0.02
R8952:Zfhx2	UTSW	14	55072750	missense	possibly damaging	0.86
R9057:Zfhx2	UTSW	14	55072570	missense	possibly damaging	0.53
R9060:Zfhx2	UTSW	14	55074346	missense	probably benign	0.00
R9197:Zfhx2	UTSW	14	55074722	nonsense	probably null
R9622:Zfhx2	UTSW	14	55066026	missense	probably benign	0.18
R9623:Zfhx2	UTSW	14	55064734	missense	probably damaging	0.98
R9775:Zfhx2	UTSW	14	55067105	missense	probably benign	0.01
R9780:Zfhx2	UTSW	14	55075037	missense	probably benign	0.02
X0065:Zfhx2	UTSW	14	55066960	missense	probably benign	0.33
Z1088:Zfhx2	UTSW	14	55074180	missense	possibly damaging	0.73
Z1177:Zfhx2	UTSW	14	55065920	missense	probably benign	0.40
Z1177:Zfhx2	UTSW	14	55066982	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CATTTGGGTCCGATATCGCC -3'
(R):5'- AGCAGTCAAGCCCACTGTAC -3'

Sequencing Primer
(F):5'- CATGCTATCTGGAACTCCGG -3'
(R):5'- TGTACCGCCCTCCCCAG -3'

Posted On

2014-12-29