Incidental Mutation 'R2915:Gdnf'
ID 254863
Institutional Source Beutler Lab
Gene Symbol Gdnf
Ensembl Gene ENSMUSG00000022144
Gene Name glial cell line derived neurotrophic factor
Synonyms glial cell line-derived neurotrophic factor
MMRRC Submission 040502-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R2915 (G1)
Quality Score 192
Status Validated
Chromosome 15
Chromosomal Location 7840327-7867056 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7845130 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 41 (V41E)
Ref Sequence ENSEMBL: ENSMUSP00000022744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022744]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000022744
AA Change: V41E

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022744
Gene: ENSMUSG00000022144
AA Change: V41E

DomainStartEndE-ValueType
low complexity region 133 146 N/A INTRINSIC
TGFB 147 240 4.36e-3 SMART
Meta Mutation Damage Score 0.5492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to lack of ureteric bud induction, bilateral renal agenesis, absence of enteric neurons, and neonatal death. Heterozygotes show renal phenotypes ranging from two small kidneys, often with abnormal shapes and cortical cysts, to unilateral renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Arhgap11a A G 2: 113,663,853 (GRCm39) V810A probably damaging Het
B3gnt6 T C 7: 97,842,800 (GRCm39) N387D probably benign Het
Col5a2 C G 1: 45,452,656 (GRCm39) G358R probably damaging Het
Cracr2a A G 6: 127,588,468 (GRCm39) K209R probably damaging Het
Dmkn A G 7: 30,464,741 (GRCm39) N32S unknown Het
Dusp13b T A 14: 21,790,205 (GRCm39) N47I probably damaging Het
Elmo2 A G 2: 165,139,573 (GRCm39) probably benign Het
Ephb6 T C 6: 41,591,172 (GRCm39) F110L probably damaging Het
Gabrb2 T A 11: 42,482,734 (GRCm39) N197K probably benign Het
Gm21915 A G 9: 40,582,083 (GRCm39) I59V possibly damaging Het
Gprin2 C T 14: 33,917,038 (GRCm39) G244D possibly damaging Het
Grin2d T C 7: 45,482,781 (GRCm39) probably benign Het
Ice2 A G 9: 69,318,122 (GRCm39) D241G probably benign Het
Mios C T 6: 8,214,935 (GRCm39) R44C possibly damaging Het
Nlrp5-ps T C 7: 14,320,636 (GRCm39) noncoding transcript Het
Nyap2 C T 1: 81,065,188 (GRCm39) R67* probably null Het
Or4d6 G A 19: 12,085,989 (GRCm39) P81L probably benign Het
Or4f14 G T 2: 111,743,064 (GRCm39) D70E probably damaging Het
Or5m8 T A 2: 85,822,389 (GRCm39) V76E probably damaging Het
Or5t9 T C 2: 86,659,570 (GRCm39) I158T probably benign Het
Or8g19 G T 9: 39,055,762 (GRCm39) R122L possibly damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Otulin A G 15: 27,619,716 (GRCm39) probably benign Het
Pax1 A G 2: 147,210,348 (GRCm39) Y361C probably damaging Het
Pcdhb12 A T 18: 37,570,693 (GRCm39) N613I probably damaging Het
Plekha5 A G 6: 140,534,925 (GRCm39) K173E probably damaging Het
Plin4 T A 17: 56,411,389 (GRCm39) T881S probably damaging Het
Poli A G 18: 70,655,771 (GRCm39) probably null Het
Prex2 T A 1: 11,240,077 (GRCm39) F898I probably damaging Het
Prr14l A T 5: 32,987,112 (GRCm39) H794Q probably benign Het
Prss1 A T 6: 41,439,545 (GRCm39) I93F probably benign Het
Ptpro C T 6: 137,391,239 (GRCm39) probably benign Het
Rad1 T C 15: 10,486,728 (GRCm39) C42R probably damaging Het
Rnf20 A G 4: 49,638,769 (GRCm39) E197G probably benign Het
Setx A G 2: 29,062,336 (GRCm39) E2260G probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Six2 A G 17: 85,992,616 (GRCm39) S296P probably damaging Het
Smg1 T A 7: 117,810,102 (GRCm39) probably benign Het
Spred2 T C 11: 19,948,215 (GRCm39) V41A probably damaging Het
Ssu2 A T 6: 112,354,566 (GRCm39) C219* probably null Het
Tbc1d9b T A 11: 50,040,563 (GRCm39) V360D possibly damaging Het
Tdrd9 G A 12: 112,006,895 (GRCm39) D920N probably damaging Het
Tyrp1 A G 4: 80,755,692 (GRCm39) T154A possibly damaging Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Wac A C 18: 7,926,131 (GRCm39) M596L possibly damaging Het
Zfhx2 G T 14: 55,302,014 (GRCm39) P1990Q probably damaging Het
Zfp853 T C 5: 143,275,332 (GRCm39) E96G unknown Het
Zzef1 G A 11: 72,801,152 (GRCm39) probably null Het
Other mutations in Gdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4377001:Gdnf UTSW 15 7,864,011 (GRCm39) missense probably benign 0.36
R1566:Gdnf UTSW 15 7,863,895 (GRCm39) missense probably benign 0.01
R1670:Gdnf UTSW 15 7,845,130 (GRCm39) missense probably benign 0.01
R5395:Gdnf UTSW 15 7,864,165 (GRCm39) missense probably damaging 1.00
R8152:Gdnf UTSW 15 7,864,243 (GRCm39) missense probably damaging 1.00
R8374:Gdnf UTSW 15 7,864,176 (GRCm39) missense probably benign 0.37
R8439:Gdnf UTSW 15 7,864,134 (GRCm39) nonsense probably null
R8491:Gdnf UTSW 15 7,864,272 (GRCm39) missense possibly damaging 0.67
R9492:Gdnf UTSW 15 7,840,423 (GRCm39) start gained probably benign
X0027:Gdnf UTSW 15 7,864,147 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCGATCAAAAGCAGTG -3'
(R):5'- TTAGTGGAGAGGCGCACAAC -3'

Sequencing Primer
(F):5'- TCAAAAGCAGTGCGGGC -3'
(R):5'- GAGAGGCGCACAACCTTCC -3'
Posted On 2014-12-29