Incidental Mutation 'R2915:Gdnf'
ID254863
Institutional Source Beutler Lab
Gene Symbol Gdnf
Ensembl Gene ENSMUSG00000022144
Gene Nameglial cell line derived neurotrophic factor
Synonymsglial cell line-derived neurotrophic factor
MMRRC Submission 040502-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R2915 (G1)
Quality Score192
Status Validated
Chromosome15
Chromosomal Location7810846-7837575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7815649 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 41 (V41E)
Ref Sequence ENSEMBL: ENSMUSP00000022744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022744
AA Change: V41E

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022744
Gene: ENSMUSG00000022144
AA Change: V41E

DomainStartEndE-ValueType
low complexity region 133 146 N/A INTRINSIC
TGFB 147 240 4.36e-3 SMART
Meta Mutation Damage Score 0.5492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to lack of ureteric bud induction, bilateral renal agenesis, absence of enteric neurons, and neonatal death. Heterozygotes show renal phenotypes ranging from two small kidneys, often with abnormal shapes and cortical cysts, to unilateral renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rad1 T C 15: 10,486,642 C42R probably damaging Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Gdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4377001:Gdnf UTSW 15 7834530 missense probably benign 0.36
R1566:Gdnf UTSW 15 7834414 missense probably benign 0.01
R1670:Gdnf UTSW 15 7815649 missense probably benign 0.01
R5395:Gdnf UTSW 15 7834684 missense probably damaging 1.00
X0027:Gdnf UTSW 15 7834666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCGATCAAAAGCAGTG -3'
(R):5'- TTAGTGGAGAGGCGCACAAC -3'

Sequencing Primer
(F):5'- TCAAAAGCAGTGCGGGC -3'
(R):5'- GAGAGGCGCACAACCTTCC -3'
Posted On2014-12-29