Incidental Mutation 'R2915:Rad1'
ID254864
Institutional Source Beutler Lab
Gene Symbol Rad1
Ensembl Gene ENSMUSG00000022248
Gene NameRAD1 checkpoint DNA exonuclease
Synonyms
MMRRC Submission 040502-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R2915 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10486018-10499063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10486642 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 42 (C42R)
Ref Sequence ENSEMBL: ENSMUSP00000126645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022855] [ENSMUST00000022856] [ENSMUST00000100775] [ENSMUST00000168408] [ENSMUST00000168761] [ENSMUST00000169050] [ENSMUST00000169519] [ENSMUST00000170100]
Predicted Effect probably benign
Transcript: ENSMUST00000022855
SMART Domains Protein: ENSMUSP00000022855
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 63 243 3.62e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022856
AA Change: C42R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022856
Gene: ENSMUSG00000022248
AA Change: C42R

DomainStartEndE-ValueType
Pfam:Rad1 16 257 2.2e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100775
AA Change: C42R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098338
Gene: ENSMUSG00000022248
AA Change: C42R

DomainStartEndE-ValueType
Pfam:Rad1 16 235 5.5e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168408
AA Change: C42R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132747
Gene: ENSMUSG00000022248
AA Change: C42R

DomainStartEndE-ValueType
Pfam:Rad1 16 67 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168690
SMART Domains Protein: ENSMUSP00000132283
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 22 147 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168761
SMART Domains Protein: ENSMUSP00000130602
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Blast:Brix 10 51 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169050
SMART Domains Protein: ENSMUSP00000127437
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Pfam:Brix 72 154 8.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169519
AA Change: C42R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126645
Gene: ENSMUSG00000022248
AA Change: C42R

DomainStartEndE-ValueType
Pfam:Rad1 16 133 9e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170100
AA Change: C12R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128601
Gene: ENSMUSG00000022248
AA Change: C12R

DomainStartEndE-ValueType
Pfam:Rad1 1 161 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170531
Meta Mutation Damage Score 0.4482 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit normal B cell DNA damage sensitivity, somatic hypermutation, and class switch recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Arhgap11a A G 2: 113,833,508 V810A probably damaging Het
B3gnt6 T C 7: 98,193,593 N387D probably benign Het
Col5a2 C G 1: 45,413,496 G358R probably damaging Het
Cracr2a A G 6: 127,611,505 K209R probably damaging Het
Dmkn A G 7: 30,765,316 N32S unknown Het
Dusp13 T A 14: 21,740,137 N47I probably damaging Het
Elmo2 A G 2: 165,297,653 probably benign Het
Ephb6 T C 6: 41,614,238 F110L probably damaging Het
Gabrb2 T A 11: 42,591,907 N197K probably benign Het
Gdnf T A 15: 7,815,649 V41E possibly damaging Het
Gm21915 A G 9: 40,670,787 I59V possibly damaging Het
Gprin2 C T 14: 34,195,081 G244D possibly damaging Het
Grin2d T C 7: 45,833,357 probably benign Het
Ice2 A G 9: 69,410,840 D241G probably benign Het
Mios C T 6: 8,214,935 R44C possibly damaging Het
Nlrp5-ps T C 7: 14,586,711 noncoding transcript Het
Nyap2 C T 1: 81,087,471 R67* probably null Het
Olfr1031 T A 2: 85,992,045 V76E probably damaging Het
Olfr1094 T C 2: 86,829,226 I158T probably benign Het
Olfr1306 G T 2: 111,912,719 D70E probably damaging Het
Olfr1428 G A 19: 12,108,625 P81L probably benign Het
Olfr27 G T 9: 39,144,466 R122L possibly damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Otulin A G 15: 27,619,630 probably benign Het
Pax1 A G 2: 147,368,428 Y361C probably damaging Het
Pcdhb12 A T 18: 37,437,640 N613I probably damaging Het
Plekha5 A G 6: 140,589,199 K173E probably damaging Het
Plin4 T A 17: 56,104,389 T881S probably damaging Het
Poli A G 18: 70,522,700 probably null Het
Prex2 T A 1: 11,169,853 F898I probably damaging Het
Prr14l A T 5: 32,829,768 H794Q probably benign Het
Prss1 A T 6: 41,462,611 I93F probably benign Het
Ptpro C T 6: 137,414,241 probably benign Het
Rnf20 A G 4: 49,638,769 E197G probably benign Het
Setx A G 2: 29,172,324 E2260G probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Six2 A G 17: 85,685,188 S296P probably damaging Het
Smg1 T A 7: 118,210,879 probably benign Het
Spred2 T C 11: 19,998,215 V41A probably damaging Het
Ssu2 A T 6: 112,377,605 C219* probably null Het
Tbc1d9b T A 11: 50,149,736 V360D possibly damaging Het
Tdrd9 G A 12: 112,040,461 D920N probably damaging Het
Tyrp1 A G 4: 80,837,455 T154A possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Wac A C 18: 7,926,131 M596L possibly damaging Het
Zfhx2 G T 14: 55,064,557 P1990Q probably damaging Het
Zfp853 T C 5: 143,289,577 E96G unknown Het
Zzef1 G A 11: 72,910,326 probably null Het
Other mutations in Rad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Rad1 APN 15 10490409 missense probably benign 0.06
IGL01536:Rad1 APN 15 10493200 missense possibly damaging 0.94
IGL01544:Rad1 APN 15 10490379 missense probably damaging 0.99
IGL02058:Rad1 APN 15 10493275 missense probably benign 0.01
IGL02368:Rad1 APN 15 10493251 missense probably benign 0.19
IGL02793:Rad1 APN 15 10493279 missense probably benign 0.00
IGL02875:Rad1 APN 15 10493279 missense probably benign 0.00
R0271:Rad1 UTSW 15 10490457 unclassified probably null
R1874:Rad1 UTSW 15 10488006 missense probably damaging 1.00
R2154:Rad1 UTSW 15 10486635 missense possibly damaging 0.77
R2318:Rad1 UTSW 15 10490409 missense probably benign 0.06
R2369:Rad1 UTSW 15 10486659 missense probably damaging 1.00
R2875:Rad1 UTSW 15 10490331 missense probably benign 0.09
R2876:Rad1 UTSW 15 10490331 missense probably benign 0.09
R3721:Rad1 UTSW 15 10488026 missense probably benign 0.00
R4754:Rad1 UTSW 15 10493126 intron probably benign
R4931:Rad1 UTSW 15 10492762 intron probably benign
R5274:Rad1 UTSW 15 10487973 intron probably null
R5640:Rad1 UTSW 15 10495923 missense possibly damaging 0.47
R5885:Rad1 UTSW 15 10488057 missense probably damaging 1.00
R6056:Rad1 UTSW 15 10488074 missense probably damaging 0.99
R6341:Rad1 UTSW 15 10492821 missense probably damaging 0.99
R6420:Rad1 UTSW 15 10488012 missense probably benign 0.00
R7068:Rad1 UTSW 15 10490293 nonsense probably null
R7205:Rad1 UTSW 15 10493257 missense probably benign 0.00
R7312:Rad1 UTSW 15 10493281 missense probably benign 0.00
R7817:Rad1 UTSW 15 10493318 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCCGGAAGAGGAGCATC -3'
(R):5'- CGTTATCTGTGTGAGACAAGATGG -3'

Sequencing Primer
(F):5'- GGAGCATCCTTCTTCTCGGAG -3'
(R):5'- CAAGATGGGGAAAGTATTTGTTGGC -3'
Posted On2014-12-29